OBM Genetics

(ISSN 2577-5790)

OBM Genetics is an international Open Access journal published quarterly online by LIDSEN Publishing Inc. It accepts papers addressing basic and medical aspects of genetics and epigenetics and also ethical, legal and social issues. Coverage includes clinical, developmental, diagnostic, evolutionary, genomic, mitochondrial, molecular, oncological, population and reproductive aspects. It publishes a variety of article types (Original Research, Review, Communication, Opinion, Comment, Conference Report, Technical Note, Book Review, etc.). There is no restriction on the length of the papers and we encourage scientists to publish their results in as much detail as possible.

Publication Speed (median values for papers published in 2025): Submission to First Decision: 9.4 weeks; Submission to Acceptance: 15.6 weeks; Acceptance to Publication: 9.2 days (1-2 days of FREE language polishing included)
Open Access Case Report

A Case of Prenatal Diagnosis of Apert Syndrome in the Second Trimester of Pregnancy

Anastasiia Kornutii 1, Oleksandr Kornutii 1, Ivanna Shymanska 2,3,*, Maiia Bondarenko 1, Natalia Prokopchuk 4

  1. Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine

  2. Scientific Medical Genetic Center “LeoGENE”, Lviv, Ukraine

  3. Lviv Regional Clinical Perinatal Center, Lviv, Ukraine

  4. Danylo Halytsky Lviv National Medical University, Lviv, Ukraine

Correspondence: Ivanna Shymanska

Academic Editor: Andre Megarbane

Received: September 12, 2025 | Accepted: March 22, 2026 | Published: April 13, 2026

OBM Genetics 2026, Volume 10, Issue 2, doi:10.21926/obm.genet.2602335

Recommended citation: Kornutii A, Kornutii O, Shymanska I, Bondarenko M, Prokopchuk N. A Case of Prenatal Diagnosis of Apert Syndrome in the Second Trimester of Pregnancy. OBM Genetics 2026; 10(2): 335; doi:10.21926/obm.genet.2602335.

© 2026 by the authors. This is an open access article distributed under the conditions of the Creative Commons by Attribution License, which permits unrestricted use, distribution, and reproduction in any medium or format, provided the original work is correctly cited.

Abstract

Craniosynostosis is a disorder characterized by premature closure of cranial sutures, resulting in restricted skull growth perpendicular to the affected suture and compensatory growth in other directions. Over 180 syndromes have been classified under craniosynostosis, of which eight are associated with mutations in the fibroblast growth factor receptor 2 (FGFR2) gene: isolated coronal synostosis, Pfeiffer syndrome, Crouzon syndrome, Apert syndrome, Beare–Stevens syndrome, Jackson–Weiss syndrome, Crouzon syndrome with acanthosis nigricans, and Muenke syndrome. Apert syndrome (acrocephalosyndactyly type I) accounts for approximately 4.5% of all craniosynostosis cases, with a prevalence ranging from 1 to 15 per 100,000-160,000 live births. In Ukraine, the prevalence of this syndrome has not been studied. Although the causative gene has been identified, the precise role of FGFR2 mutations in craniofacial dysmorphology and related anomalies remains under investigation. Much of the current understanding of this rare disorder has been facilitated through mouse models. In this report, we present a rare case of prenatally diagnosed Apert syndrome during the second trimester of pregnancy in a young couple with a history of primary infertility and two early pregnancy losses. Postmortem molecular analysis of placental chorionic cells identified a pathogenic FGFR2 mutation (c.755C>G; p.Ser252Trp), enabling precise confirmation of the diagnosis.

Keywords

Apert’s syndrome; FGFR2 variant; craniosynostosis

1. Introduction

Apert syndrome was initially reported by Wheaton in 1894 and subsequently delineated in greater detail by the French physician Eugène Charles Apert, who described nine affected individuals in 1906 [1]. This syndrome represents a rare autosomal dominant craniosynostosis disorder characterized by premature coronal suture fusion, complex syndactyly of the hands and feet, brachycephaly, midfacial hypoplasia, central nervous system malformations, and variable degrees of intellectual disability [2].

Pathogenic variants in FGFR2 are well established as the primary molecular cause of syndromic craniosynostoses, including Apert syndrome, leading to dysregulated fibroblast growth factor signaling and premature cranial suture fusion [3]. Previous studies have demonstrated genotype–phenotype correlations and molecular mechanisms underlying FGFR2-related craniosynostosis syndromes [3], as well as their epidemiological characteristics, including birth prevalence and demographic distribution [4,5]. Experimental models further support the role of dysregulation of the fibroblast growth factor pathway in skeletal and visceral developmental abnormalities [6,7]. Together, these data highlight the critical role of FGFR signaling in craniofacial development and support the clinical relevance of molecular diagnostics for accurate diagnosis, prognosis assessment, and genetic counseling in affected families.

Prenatal recognition of Apert syndrome remains challenging. In most published cases, diagnosis has been established during the third trimester, when craniofacial dysmorphism and cranial abnormalities become more conspicuous on routine ultrasonography [8]. This case report aims to highlight the diagnostic value of second-trimester prenatal ultrasound, including advanced 3D imaging, for early recognition of Apert syndrome, and to demonstrate how detailed prenatal imaging combined with molecular confirmation of a pathogenic FGFR2 variant can support accurate diagnosis, counseling, and clinical decision-making.

2. Case Report

A non-consanguineous couple, a 26-year-old woman and a 30-year-old man, presented with a history of primary infertility for three years. The first two pregnancies ended in missed abortions at 8 and 9 weeks of gestation, respectively; cytogenetic analysis was not performed in either case. The gynecological history was remarkable for a dermoid ovarian cyst, and following the two pregnancy losses, the patient underwent hysteroscopic resection of a uterine septum.

The family history was unremarkable, with no evidence of hereditary disorders, consanguinity, or exposure to environmental teratogens. The index pregnancy (the third) was planned and conceived spontaneously. Preconceptional folic acid supplementation (400 μg/day) was taken for two months. The pregnancy was complicated by threatened miscarriage from 4-5 weeks of gestation, for which the patient received progesterone therapy.

First-trimester combined screening did not indicate an increased risk for common chromosomal abnormalities. Biochemical markers showed PAPP-A: 1.21 MoM and free β-hCG: 0.75 MoM. First-trimester ultrasound did not reveal markers of chromosomal abnormalities or structural malformations. At 16 weeks, maternal serum α-fetoprotein measured 0.87 MoM, consistent with a low risk for neural tube defects.

At the second-trimester ultrasound (21 weeks + 5 days), multiple congenital anomalies were detected. Notably, there was mild asymmetric ventriculomegaly with bilateral lateral ventricle dilation to 10 mm (normal ≤5.2 mm). Craniofacial abnormalities included acrocephaly, hypertelorism, prominent orbits, depressed nasal bridge, flattened facial profile, micro retrognathia, and low-set auricles (Figure 1). Neurosonographic findings demonstrated intact falx cerebri, normal thalamus, cavum septi pellucidi (3.1 mm), corpus callosum (21.6 mm), cisterna magna (4.6 mm), choroid plexus, and Sylvian fissure (6.6 mm). The spine was structurally normal.

Click to view original image

Figure 1 Fetal profile with signs of acrocephaly, sunken nose, bulging orbits, microretrognathia, low-set ears.

Cardiac assessment revealed a muscular ventricular septal defect. Skeletal abnormalities included bilateral syndactyly of digits 2-5 (Figure 2), thickened proximal phalanges of the lower limbs, and deviation of the halluxes (Figure 3).

Click to view original image

Figure 2 Forced position of the fingers, syndactyly.

Click to view original image

Figure 3 Lower limbs of the fetus.

Fetal biometry was consistent with 21.5 weeks, in agreement with the gestational age of 21.3 weeks.

Given the constellation of multiple congenital anomalies and the poor prognosis for postnatal survival and quality of life, the parents elected to terminate the pregnancy. Fetal demise was induced via administration of prostaglandin suppositories into the posterior vaginal fornix, and spontaneous vaginal delivery occurred. The stillborn fetus weighed 450 grams and measured 18 cm in crown–heel length.

Gross pathological examination revealed characteristic features of coronal craniosynostosis with abnormal skull configuration, as well as bilateral syndactyly of both hands and feet (Figure 4). These findings were consistent with the prenatal ultrasound diagnosis of Apert syndrome.

Click to view original image

Figure 4 A fetus with signs of acrocephalosyndactyly.

To confirm the prenatal diagnosis, molecular genetic testing was performed on placental tissue following pregnancy termination. Sanger sequencing was carried out using the chain-termination method with fluorescently labeled dideoxynucleotides (ddNTPs). The target DNA fragment was amplified using specific primers (F 5’ CCGGCAGTCTCCTTTGAAGT 3’, R 5’ CCTTGAGGTAGGGCAGCC 3’), followed by a sequencing reaction using a commercial kit BrilliantDye™ Terminator, v 3.1 (NimaGen).

The resulting products were separated by size using capillary electrophoresis and analyzed on a SeqStudio Genetic Analyzer (ThermoFisher, USA). Sequence data were interpreted with FinchTV software and verified using the BLAST algorithm. Primer design was performed using the PRIMER3Plus online tool (https://www.primer3plus.com/), and product specificity was confirmed with in silico PCR (UCSC Genome Browser: https://genome.ucsc.edu/cgi-bin/hgPcr).

The sequencing chromatogram confirmed the presence of the Ser252Trp (S252W) variant in the FGFR2 gene, which is a well-established pathogenic variant associated with Apert syndrome (Figure 5).

Click to view original image

Figure 5 Chromatogram of the Ser252Trp variant of the FGFR2 gene.

2.1 Ethics Statement

The study was approved by an ethics committee (Ivano-Frankivsk National Medical University, protocol number 153/25 ‘17.09.2025’), and written informed consent was obtained from the patient for publication of this case report.

3. Discussion

Apert syndrome, also known as acrocephalosyndactyly type I, is a rare autosomal dominant genetic disorder characterized by multi-sutural craniosynostosis, midfacial retrusion, and syndactyly. The condition is caused by pathogenic variants in the FGFR2 gene, which encodes fibroblast growth factor receptor 2—a protein essential for regulating cell proliferation and bone development, particularly during craniofacial and limb morphogenesis. Pathogenic variants in this gene lead to aberrant osteogenesis and premature suture fusion.

Advanced paternal age is a well-established risk factor for de novo FGFR2 variants associated with Apert syndrome. Diagnosis is typically based on distinctive clinical features, which can be confirmed by molecular genetic testing targeting FGFR2 variants.

In most cases, the condition results from gain-of-function missense variants in exon IIIa of FGFR2 (chromosome 10q26), most commonly Ser252Trp (S252W) and Pro253Arg (P253R) [9,10]. Phenotypic differences have been described between these variants: the P253R variant is frequently associated with more severe syndactyly, whereas the S252W variant has been more strongly associated with cleft palate [11,12]. In the present case, a cleft palate was not observed.

Beyond craniofacial and limb abnormalities, patients often exhibit developmental and neurological impairments. Approximately 50% of affected individuals demonstrate some degree of intellectual disability, with IQ values ranging from <35 to within the normal range [13].

Apert syndrome is most frequently attributed to gain-of-function missense variants in exon IIIa of the FGFR2 gene (10q26), resulting in recurrent amino acid substitutions p.Ser252Trp and p.Pro253Arg [9,10]. These variants affect the linker region between the IgII and IgIII domains of FGFR2, thereby altering ligand-binding specificity and enhancing downstream signaling.

Genotype–phenotype correlations have been documented: the p.Pro253Arg variant is commonly associated with more severe syndactyly, whereas the p.Ser252Trp variant shows a stronger association with cleft palate formation [11,12]. In the present case, no evidence of cleft palate was observed.

Neurological involvement is variably present, with approximately 50% of affected individuals demonstrating some degree of cognitive impairment, ranging from severe intellectual disability (IQ <35) to normal cognitive performance. Developmental delay and other neurodevelopmental problems are frequently reported. Genotype–phenotype correlations are present in Table 1.

Table 1 Genotype–phenotype correlations in FGFR2-related Apert syndrome.

Prenatal diagnosis of Apert syndrome in sporadic cases is particularly challenging, as the characteristic sonographic features of craniosynostosis may not be apparent until the third trimester [14]. In one reported case, increased nuchal translucency was observed during the first trimester despite a normal fetal karyotype [15]. The presence of ocular hypertelorism and proptosis is a highly suggestive indicator of Apert syndrome [2,16]. Another hallmark feature is midfacial hypoplasia, which typically manifests as a deeply depressed nasal bridge that appears short and broad, often with a bulbous nasal tip [14]. In the present case, the combination of hypertelorism and cranial deformity strongly indicated Apert syndrome.

Several reports have also described abnormal ear morphology in affected fetuses. In a study by Farkas, all subjects exhibited low-set ears with a tendency toward disproportion, enlargement, and slight angulation of the longitudinal axis [17]. Similarly, in our case, the fetus demonstrated low-set auricles.

Limb anomalies are a consistent diagnostic hallmark of Apert syndrome, particularly upper-extremity syndactyly. This feature distinguishes Apert syndrome from other FGFR-related craniosynostosis syndromes (Table 2). Careful 2D and 3D ultrasonographic examination of the extremities confirmed bilateral syndactyly in our case. Notably, although the fetal feet were abnormally positioned, true talipes was not present. Visualization of digital fusion in utero is often difficult; however, in this case, shortened feet held in an abnormal position were secondary to syndactyly.

Table 2 FGFR2-Associated Craniosynostosis Syndromes and Their Related Variants.

Furthermore, 3D ultrasonography has been shown to detect premature coronal suture closure in Apert syndrome [9]. Beyond diagnostic utility, the use of 3D imaging to demonstrate fetal anomalies to the parents proved particularly valuable in this case, aiding in parental counseling and decision-making.

The Pro253Arg variant enhances the affinity of FGFR2 for fibroblast growth factors (FGFs), thereby altering the kinetics of receptor–ligand interactions. Specifically, this variant is associated with a selective reduction in the dissociation rate of FGF2, whereas other FGFs examined do not exhibit comparable effects. Such alterations disrupt the regulation of signaling pathways mediated by α-epidermal growth factor (EGF) and platelet-derived growth factor (PDGF), which are thought to contribute to premature cranial suture fusion.

The hallmark phenotypic manifestation of Apert syndrome is craniosynostosis, arising from premature fusion of cranial sutures. FGFR2 variants increase the pool of osteogenic precursor cells, facilitating early ossification and accelerated bone matrix deposition. The Ser252Trp variant is more frequently associated with cleft palate, representing a secondary developmental anomaly. A clinical case has been reported in which a patient carrying the Pro253Arg variant presented with Apert syndrome alongside early-onset, low-grade papillary carcinoma [18].

Experimental data indicate that FGFR2 variants promote activation of osteogenic signaling cascades, ultimately resulting in aberrant cranial ossification. Moreover, dysregulation of EGF and PDGF pathways plays an additional role in pathological suture fusion. The altered binding affinity of FGFR2 for FGF—particularly in the context of the Pro253Arg substitution—significantly impacts the functional dynamics of receptor–ligand interactions.

Taken together, the pathogenesis of Apert syndrome illustrates a complex interplay between genetic variants, molecular signaling networks, and cellular processes, underscoring the pivotal role of FGFR2 in disease development. Multidisciplinary management of Apert syndrome has been advocated, encompassing surgical intervention, orthodontic care, and psychological support [19,20].

4. Patient Perspective

The couple reported that the ultrasound provided a clearer understanding of the condition's severity and enabled them to make a well-informed decision.

5. Conclusion

This case demonstrates that a detailed second-trimester prenatal ultrasound, particularly when supplemented with 3D imaging, can enable early recognition of Apert syndrome and guide targeted molecular testing. Molecular confirmation of a pathogenic FGFR2 variant provides diagnostic certainty and supports appropriate genetic counseling.

While this report includes a history of infertility and pregnancy loss, these findings should be interpreted as part of the individual clinical context rather than evidence of a generalized increased genetic risk. Larger studies are required to explore any potential associations.

The integration of advanced prenatal imaging and molecular diagnostics remains essential for the accurate diagnosis of rare craniofacial syndromes and for informed prenatal counseling.

Author Contributions

Anastasiia Kornutii established a possible diagnosis based on fetal signs. Oleksandr Kornutii established a possible diagnosis based on fetal signs. Ivanna Shymanska developed a design for Sanger sequencing and performed sequencing. Maiia Bondarenko counseled the couple prepared the text of the article. Natalia Prokopchuk performed ultrasound diagnostics and suspected a violation.

Competing Interests

The authors have declared that no competing interests exist.

References

  1. Apert E. De l’acrocephalosyndactylie. Bull Soc Med Hop Paris. 1906; 23: 1310-1313. [Google scholar]
  2. Souayeh N, Marzouk A, Rouis H, Mbarki C, Bettaieb H. Prenatal diagnosis and management of Apert syndrome in a low-middle income country: Case report. Int J Surg Case Rep. 2024; 122: 110134. [CrossRef] [Google scholar]
  3. Azoury SC, Reddy S, Shukla V, Deng CX. Fibroblast growth factor receptor 2 (FGFR2) mutation related syndromic craniosynostosis. Int J Biol Sci. 2017; 13: 1479-1488. [CrossRef] [Google scholar]
  4. Tolarova MM, Harris JA, Ordway DE, Vargervik K. Birth prevalence, mutation rate, sex ratio, parents’ age, and ethnicity in Apert syndrome. Am J Med Genet. 1997; 72: 394-398. [CrossRef] [Google scholar]
  5. Cohen Jr MM, Kreiborg S, Lammer EJ, Cordero JF, Mastroiacovo P, Erickson JD, et al. Birth prevalence study of the Apert syndrome. Am J Med Genet. 1992; 42: 655-659. [CrossRef] [Google scholar]
  6. Hajihosseini MK, Duarte R, Pegrum J, Donjacour A, Lana-Elola E, Rice DP, et al. Evidence that FGF10 contributes to the skeletal and visceral defects of an Apert syndrome mouse model. Dev Dyn. 2009; 238: 376-385. [CrossRef] [Google scholar]
  7. Wilkie AO, Morriss-Kay GM. Genetics of craniofacial development and malformation. Nat Rev Genet. 2001; 2: 458-468. [CrossRef] [Google scholar]
  8. Varlas VN, Epistatu D, Varlas RG. Emphasis on early prenatal diagnosis and perinatal outcomes analysis of Apert syndrome. Diagnostics. 2024; 14: 1480. [CrossRef] [Google scholar]
  9. Wilkie AO, Slaney SF, Oldridge M, Poole MD, Ashworth GJ, Hockley AD, et al. Apert syndrome results from localized mutations of FGFR2 and is allelic with Crouzon syndrome. Nat Genet. 1995; 9: 165-172. [CrossRef] [Google scholar]
  10. Das S, Munshi A. Research advances in Apert syndrome. J Oral Biol Craniofac Res. 2018; 8: 194-199. [CrossRef] [Google scholar]
  11. Slaney SF, Oldridge M, Hurst JA, Moriss-Kay GM, Hall CM, Poole MD, et al. Differential effects of FGFR2 mutations on syndactyly and cleft palate in Apert syndrome. Am J Hum Genet. 1996; 58: 923-932. [Google scholar]
  12. Von Gernet S, Golla A, Ehrenfels Y, Schuffenhauer S, Fairley JD. Genotype–phenotype analysis in Apert syndrome suggests opposite effects of the two recurrent mutations on syndactyly and outcome of craniofacial surgery. Clin Genet. 2000; 57: 137-139. [CrossRef] [Google scholar]
  13. Renier D, Arnaud E, Cinalli G, Sebag G, Zerah M, Marchac D. Prognosis for mental function in Apert’s syndrome. J Neurosurg. 1996; 85: 66-72. [CrossRef] [Google scholar]
  14. Lynett D, Lubo LM, Rojas AL, Rodríguez OP, Ramirez LB, Jimenez D, et al. Detection of a genetic variant of Apert syndrome. Genetics. 2024. doi: 10.37980/im.journal.ggcl.20242459. [CrossRef] [Google scholar]
  15. David AL, Turnbull C, Scott R, Freeman J, Bilardo CM, Van Maarle M, et al. Diagnosis of Apert syndrome in the second‐trimester using 2D and 3D ultrasound. Prenat Diagn. 2007; 27: 629-632. [CrossRef] [Google scholar]
  16. Casteleyn T, Horn D, Henrich W, Verlohren S. Differential diagnosis of syndromic craniosynostosis: A case series. Arch Gynecol Obstet. 2022; 306: 49-57. [CrossRef] [Google scholar]
  17. Farkas LG. Ear morphology in treacher collins’, apert’s, and crouzon’s syndromes. Arch Oto-Rhino-Laryngol. 1978; 220: 153-157. [CrossRef] [Google scholar]
  18. Andreou A, Lamy A, Layet V, Cailliez D, Gobet F, Pfister C, et al. Early-onset low-grade papillary carcinoma of the bladder associated with Apert syndrome and a germline FGFR2 mutation (Pro253Arg). Am J Med Genet A. 2006; 140: 2245-2247. [CrossRef] [Google scholar]
  19. Kumari K, Saleh I, Taslim S, Ahmad S, Hussain I, Munir Z, et al. Unraveling the complexity of Apert syndrome: Genetics, clinical insights, and future frontiers. Cureus. 2023; 15: e47281. [CrossRef] [Google scholar]
  20. El-Bassyouni HT, El-Kamah GY, Afifi HH, Taher MB, Soliman DR, Hamed K, et al. Insight into Apert syndrome: Reporting on six patients and increasing awareness. Mol Neurobiol. 2025; 62: 11089-11098. [CrossRef] [Google scholar]
Journal Metrics
2025
CiteScore SJR SNIP
1.20.2240.285
Newsletter
Download PDF Download Full-Text XML Download Citation
0 0

TOP