Apert syndrome was initially reported by Wheaton in 1894 and subsequently delineated in greater detail by the French physician Eugène Charles Apert, who described nine affected individuals in 1906 [1]. This syndrome represents a rare autosomal dominant craniosynostosis disorder characterized by premature coronal suture fusion, complex syndactyly of the hands and feet, brachycephaly, midfacial hypoplasia, central nervous system malformations, and variable degrees of intellectual disability [2].

Pathogenic variants in FGFR2 are well established as the primary molecular cause of syndromic craniosynostoses, including Apert syndrome, leading to dysregulated fibroblast growth factor signaling and premature cranial suture fusion [3]. Previous studies have demonstrated genotype–phenotype correlations and molecular mechanisms underlying FGFR2-related craniosynostosis syndromes [3], as well as their epidemiological characteristics, including birth prevalence and demographic distribution [4,5]. Experimental models further support the role of dysregulation of the fibroblast growth factor pathway in skeletal and visceral developmental abnormalities [6,7]. Together, these data highlight the critical role of FGFR signaling in craniofacial development and support the clinical relevance of molecular diagnostics for accurate diagnosis, prognosis assessment, and genetic counseling in affected families.

Prenatal recognition of Apert syndrome remains challenging. In most published cases, diagnosis has been established during the third trimester, when craniofacial dysmorphism and cranial abnormalities become more conspicuous on routine ultrasonography [8]. This case report aims to highlight the diagnostic value of second-trimester prenatal ultrasound, including advanced 3D imaging, for early recognition of Apert syndrome, and to demonstrate how detailed prenatal imaging combined with molecular confirmation of a pathogenic FGFR2 variant can support accurate diagnosis, counseling, and clinical decision-making.

A non-consanguineous couple, a 26-year-old woman and a 30-year-old man, presented with a history of primary infertility for three years. The first two pregnancies ended in missed abortions at 8 and 9 weeks of gestation, respectively; cytogenetic analysis was not performed in either case. The gynecological history was remarkable for a dermoid ovarian cyst, and following the two pregnancy losses, the patient underwent hysteroscopic resection of a uterine septum.

The family history was unremarkable, with no evidence of hereditary disorders, consanguinity, or exposure to environmental teratogens. The index pregnancy (the third) was planned and conceived spontaneously. Preconceptional folic acid supplementation (400 μg/day) was taken for two months. The pregnancy was complicated by threatened miscarriage from 4-5 weeks of gestation, for which the patient received progesterone therapy.

First-trimester combined screening did not indicate an increased risk for common chromosomal abnormalities. Biochemical markers showed PAPP-A: 1.21 MoM and free β-hCG: 0.75 MoM. First-trimester ultrasound did not reveal markers of chromosomal abnormalities or structural malformations. At 16 weeks, maternal serum α-fetoprotein measured 0.87 MoM, consistent with a low risk for neural tube defects.

At the second-trimester ultrasound (21 weeks + 5 days), multiple congenital anomalies were detected. Notably, there was mild asymmetric ventriculomegaly with bilateral lateral ventricle dilation to 10 mm (normal ≤5.2 mm). Craniofacial abnormalities included acrocephaly, hypertelorism, prominent orbits, depressed nasal bridge, flattened facial profile, micro retrognathia, and low-set auricles (Figure 1). Neurosonographic findings demonstrated intact falx cerebri, normal thalamus, cavum septi pellucidi (3.1 mm), corpus callosum (21.6 mm), cisterna magna (4.6 mm), choroid plexus, and Sylvian fissure (6.6 mm). The spine was structurally normal.

Cardiac assessment revealed a muscular ventricular septal defect. Skeletal abnormalities included bilateral syndactyly of digits 2-5 (Figure 2), thickened proximal phalanges of the lower limbs, and deviation of the halluxes (Figure 3).

Fetal biometry was consistent with 21.5 weeks, in agreement with the gestational age of 21.3 weeks.

Given the constellation of multiple congenital anomalies and the poor prognosis for postnatal survival and quality of life, the parents elected to terminate the pregnancy. Fetal demise was induced via administration of prostaglandin suppositories into the posterior vaginal fornix, and spontaneous vaginal delivery occurred. The stillborn fetus weighed 450 grams and measured 18 cm in crown–heel length.

Gross pathological examination revealed characteristic features of coronal craniosynostosis with abnormal skull configuration, as well as bilateral syndactyly of both hands and feet (Figure 4). These findings were consistent with the prenatal ultrasound diagnosis of Apert syndrome.

To confirm the prenatal diagnosis, molecular genetic testing was performed on placental tissue following pregnancy termination. Sanger sequencing was carried out using the chain-termination method with fluorescently labeled dideoxynucleotides (ddNTPs). The target DNA fragment was amplified using specific primers (F 5’ CCGGCAGTCTCCTTTGAAGT 3’, R 5’ CCTTGAGGTAGGGCAGCC 3’), followed by a sequencing reaction using a commercial kit BrilliantDye™ Terminator, v 3.1 (NimaGen).

The resulting products were separated by size using capillary electrophoresis and analyzed on a SeqStudio Genetic Analyzer (ThermoFisher, USA). Sequence data were interpreted with FinchTV software and verified using the BLAST algorithm. Primer design was performed using the PRIMER3Plus online tool (https://www.primer3plus.com/), and product specificity was confirmed with in silico PCR (UCSC Genome Browser: https://genome.ucsc.edu/cgi-bin/hgPcr).

The sequencing chromatogram confirmed the presence of the Ser252Trp (S252W) variant in the FGFR2 gene, which is a well-established pathogenic variant associated with Apert syndrome (Figure 5).

Apert syndrome, also known as acrocephalosyndactyly type I, is a rare autosomal dominant genetic disorder characterized by multi-sutural craniosynostosis, midfacial retrusion, and syndactyly. The condition is caused by pathogenic variants in the FGFR2 gene, which encodes fibroblast growth factor receptor 2—a protein essential for regulating cell proliferation and bone development, particularly during craniofacial and limb morphogenesis. Pathogenic variants in this gene lead to aberrant osteogenesis and premature suture fusion.

Advanced paternal age is a well-established risk factor for de novo FGFR2 variants associated with Apert syndrome. Diagnosis is typically based on distinctive clinical features, which can be confirmed by molecular genetic testing targeting FGFR2 variants.

In most cases, the condition results from gain-of-function missense variants in exon IIIa of FGFR2 (chromosome 10q26), most commonly Ser252Trp (S252W) and Pro253Arg (P253R) [9,10]. Phenotypic differences have been described between these variants: the P253R variant is frequently associated with more severe syndactyly, whereas the S252W variant has been more strongly associated with cleft palate [11,12]. In the present case, a cleft palate was not observed.

Beyond craniofacial and limb abnormalities, patients often exhibit developmental and neurological impairments. Approximately 50% of affected individuals demonstrate some degree of intellectual disability, with IQ values ranging from <35 to within the normal range [13].

Apert syndrome is most frequently attributed to gain-of-function missense variants in exon IIIa of the FGFR2 gene (10q26), resulting in recurrent amino acid substitutions p.Ser252Trp and p.Pro253Arg [9,10]. These variants affect the linker region between the IgII and IgIII domains of FGFR2, thereby altering ligand-binding specificity and enhancing downstream signaling.

Genotype–phenotype correlations have been documented: the p.Pro253Arg variant is commonly associated with more severe syndactyly, whereas the p.Ser252Trp variant shows a stronger association with cleft palate formation [11,12]. In the present case, no evidence of cleft palate was observed.

Neurological involvement is variably present, with approximately 50% of affected individuals demonstrating some degree of cognitive impairment, ranging from severe intellectual disability (IQ <35) to normal cognitive performance. Developmental delay and other neurodevelopmental problems are frequently reported. Genotype–phenotype correlations are present in Table 1.

Prenatal diagnosis of Apert syndrome in sporadic cases is particularly challenging, as the characteristic sonographic features of craniosynostosis may not be apparent until the third trimester [14]. In one reported case, increased nuchal translucency was observed during the first trimester despite a normal fetal karyotype [15]. The presence of ocular hypertelorism and proptosis is a highly suggestive indicator of Apert syndrome [2,16]. Another hallmark feature is midfacial hypoplasia, which typically manifests as a deeply depressed nasal bridge that appears short and broad, often with a bulbous nasal tip [14]. In the present case, the combination of hypertelorism and cranial deformity strongly indicated Apert syndrome.

Several reports have also described abnormal ear morphology in affected fetuses. In a study by Farkas, all subjects exhibited low-set ears with a tendency toward disproportion, enlargement, and slight angulation of the longitudinal axis [17]. Similarly, in our case, the fetus demonstrated low-set auricles.

Limb anomalies are a consistent diagnostic hallmark of Apert syndrome, particularly upper-extremity syndactyly. This feature distinguishes Apert syndrome from other FGFR-related craniosynostosis syndromes (Table 2). Careful 2D and 3D ultrasonographic examination of the extremities confirmed bilateral syndactyly in our case. Notably, although the fetal feet were abnormally positioned, true talipes was not present. Visualization of digital fusion in utero is often difficult; however, in this case, shortened feet held in an abnormal position were secondary to syndactyly.

Furthermore, 3D ultrasonography has been shown to detect premature coronal suture closure in Apert syndrome [9]. Beyond diagnostic utility, the use of 3D imaging to demonstrate fetal anomalies to the parents proved particularly valuable in this case, aiding in parental counseling and decision-making.

The Pro253Arg variant enhances the affinity of FGFR2 for fibroblast growth factors (FGFs), thereby altering the kinetics of receptor–ligand interactions. Specifically, this variant is associated with a selective reduction in the dissociation rate of FGF2, whereas other FGFs examined do not exhibit comparable effects. Such alterations disrupt the regulation of signaling pathways mediated by α-epidermal growth factor (EGF) and platelet-derived growth factor (PDGF), which are thought to contribute to premature cranial suture fusion.

The hallmark phenotypic manifestation of Apert syndrome is craniosynostosis, arising from premature fusion of cranial sutures. FGFR2 variants increase the pool of osteogenic precursor cells, facilitating early ossification and accelerated bone matrix deposition. The Ser252Trp variant is more frequently associated with cleft palate, representing a secondary developmental anomaly. A clinical case has been reported in which a patient carrying the Pro253Arg variant presented with Apert syndrome alongside early-onset, low-grade papillary carcinoma [18].

Experimental data indicate that FGFR2 variants promote activation of osteogenic signaling cascades, ultimately resulting in aberrant cranial ossification. Moreover, dysregulation of EGF and PDGF pathways plays an additional role in pathological suture fusion. The altered binding affinity of FGFR2 for FGF—particularly in the context of the Pro253Arg substitution—significantly impacts the functional dynamics of receptor–ligand interactions.

Taken together, the pathogenesis of Apert syndrome illustrates a complex interplay between genetic variants, molecular signaling networks, and cellular processes, underscoring the pivotal role of FGFR2 in disease development. Multidisciplinary management of Apert syndrome has been advocated, encompassing surgical intervention, orthodontic care, and psychological support [19,20].

The couple reported that the ultrasound provided a clearer understanding of the condition's severity and enabled them to make a well-informed decision.

This case demonstrates that a detailed second-trimester prenatal ultrasound, particularly when supplemented with 3D imaging, can enable early recognition of Apert syndrome and guide targeted molecular testing. Molecular confirmation of a pathogenic FGFR2 variant provides diagnostic certainty and supports appropriate genetic counseling.

While this report includes a history of infertility and pregnancy loss, these findings should be interpreted as part of the individual clinical context rather than evidence of a generalized increased genetic risk. Larger studies are required to explore any potential associations.

The integration of advanced prenatal imaging and molecular diagnostics remains essential for the accurate diagnosis of rare craniofacial syndromes and for informed prenatal counseling.