<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3.dtd">
<article 
  article-type="research-article" 
  dtd-version="1.3" 
  xml:lang="en"
  xmlns:mml="http://www.w3.org/1998/Math/MathML" 
  xmlns:xlink="http://www.w3.org/1999/xlink"
  xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
  <processing-meta
    tagset-family="jats"
    base-tagset="publishing"
    mathml-version="2.0"
    table-model="xhtml"/>
    <front>
        <journal-meta>
            <journal-id journal-id-type="publisher-id">obm-genet</journal-id>
            <journal-title-group>
                <journal-title>OBM Genetics</journal-title>
                <abbrev-journal-title>OBM Genet</abbrev-journal-title>
            </journal-title-group>
            <issn pub-type="epub">2577-5790</issn>
            <issn-l>2577-5790</issn-l>
            <publisher>
                <publisher-name>LIDSEN Publishing Inc.</publisher-name>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="publisher-id">genetics-10-02-338</article-id>
            <article-id pub-id-type="doi">10.21926/obm.genet.2602338</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Original Research</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Clinical Variabilities of <italic>PTPN11</italic> Pathogenic Variant in Indonesian Noonan Syndrome Patients</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Hadi</surname>
                        <given-names>Nisa Ayu Thayalisha</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff-01">1</xref>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Utari</surname>
                        <given-names>Agustini</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff-02">2</xref>
                    <xref ref-type="aff" rid="aff-03">3</xref>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Sihombing</surname>
                        <given-names>Nydia Rena Benita</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff-03">3</xref>
                    <xref ref-type="aff" rid="aff-04">4</xref>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Winarni</surname>
                        <given-names>Tri Indah</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff-03">3</xref>
                    <xref ref-type="aff" rid="aff-04">4</xref>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Maharani</surname>
                        <given-names>Nani</given-names>
                    </name>
                    <xref ref-type="aff" rid="aff-03">3</xref>
                    <xref ref-type="aff" rid="aff-05">5</xref>
                    <xref rid="cor-01" ref-type="corresp"><sup>&#x002A;</sup></xref>
                </contrib>
                <aff id="aff-01"><label>1</label>Master of Biomedical Science&#x2013;Majoring Genetic Counselling, Faculty of Medicine, Universitas Diponegoro, Semarang, Central Java, Indonesia; E-Mail: <email>niatha_hadi@yahoo.com</email></aff>
                <aff id="aff-02"><label>2</label>Department of Pediatrics, Faculty of Medicine, Universitas Diponegoro, Semarang, Central Java, Indonesia; E-Mail: <email>agustiniutari@lecturer.undip.ac.id</email></aff>
                <aff id="aff-03"><label>3</label>Center for Biomedical Research (CEBIOR), Faculty of Medicine, Universitas Diponegoro, Semarang, Central Java, Indonesia; E-Mails: <email>nydiasihombing@fk.undip.ac.id</email>; <email>triwinarni@lecturer.undip.ac.id</email>; <email>maharani.nani@fk.undip.ac.id</email></aff>
                <aff id="aff-04"><label>4</label>Department of Anatomy, Faculty of Medicine, Universitas Diponegoro, Semarang, Central Java, Indonesia</aff>
                <aff id="aff-05"><label>5</label>Department of Pharmacology and Therapy, Faculty of Medicine, Universitas Diponegoro, Semarang, Central Java, Indonesia</aff>
            </contrib-group>
            <contrib-group>
                <contrib contrib-type="editor">
                    <name>
                        <surname>Stasolla</surname>
                        <given-names>Fabrizio</given-names>
                    </name>
                    <role>Academic Editor</role>
                </contrib>
            </contrib-group>
            <author-notes>
                <corresp id="cor-01"><label>&#x002A;</label>Correspondence: Nani Maharani; E-Mail: <email>maharani.nani@fk.undip.ac.id</email></corresp>
            </author-notes> 
            <pub-date date-type="pub" publication-format="electronic" iso-8601-date="2026-05-06">
                <day>06</day>
                <month>05</month>
                <year>2026</year>
            </pub-date> 
            <volume>10</volume>
            <issue>2</issue>
            <elocation-id>338</elocation-id>
            <history>
                <date date-type="received" iso-8601-date="2026-01-08">
                    <day>08</day>
                    <month>01</month>
                    <year>2026</year>
                </date>
                <date date-type="accepted" iso-8601-date="2026-04-15">
                    <day>15</day>
                    <month>04</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>&#xA9; 2026 by the authors.</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/2.0/">
                    <license-p>This is an open access article distributed under the conditions of the Creative Commons by Attribution License, which permits unrestricted use, distribution, and reproduction in any medium or format, provided the original work is correctly cited.</license-p>
                </license>      
            </permissions>
            <abstract>
                <p>Noonan syndrome (NS) is an autosomal dominant disorder with a wide spectrum of symptoms and clinical phenotypes, including short stature, congenital heart defects (CHD), and distinctive facial features. A pathogenic variant in the <italic>PTPN11</italic> gene is the major cause of NS. This is a preliminary study in Indonesia involving 29 patients with clinical features of NS. Detailed clinical and echocardiography data were collected. Genomic DNA was extracted from a peripheral blood sample. Exome sequencing or PCR followed by Sanger DNA sequencing was done. Variant pathogenicity was assessed using the ClinVar database, while the novel variant was analyzed in silico using PolyPhen, Rare Exome Variant Ensemble Learner (REVEL), SIFT, FATHMM Pred, and MutationTaster. Clinical findings in 18 patients showed a typical craniofacial feature of NS, including low-posteriorly rotated ear (83.3%), microcephaly, downslanted palpebral fissures, and a short-webbed neck in 50%, and hypertelorism and a depressed nasal bridge in 44.4%. Other clinical variabilities included CHD (83.3%), thoracic and musculoskeletal deformities (77.8%), short stature (72.2%), and intellectual disability (ID) (50%). A novel variant in exon 3 of <italic>PTPN11</italic> was found in one patient: c.140G&#x003E;A (p.Arg47Lys), which was predicted to be probably damaging. A variant in exon 8, the c.907G&#x003E;A (p.Asp303Asn), was found in 11 patients. This variant is not in the ClinVar database yet; however, it was reported in a case report and predicted to be probably damaging. One patient has a variant c.184T&#x003E;G (p.Tyr62Asp), 1 patient has c.854T&#x003E;C (p.Phe285Ser), 1 patient has c.922A&#x003E;G (p.Asn308Asp), 2 patients have c.1510A&#x003E;G (p.Met504Val), and 1 patient has c.1517A&#x003E;C (p.Gln506Pro), those variants have been previously reported. Sequencing on the remaining exons of <italic>PTPN11</italic> is still ongoing. NS patients with <italic>PTPN11</italic> variants demonstrate diverse clinical manifestations. Clinicians&#x2019; awareness of suspecting NS is essential for early diagnosis, particularly in children with short stature, ID, and CHD who have a distinctive facial dysmorphism at any age.</p>
            </abstract>
            <kwd-group>
                <title>Keywords</title>
                <kwd><italic>PTPN11</italic></kwd>
                <kwd>Noonan syndrome</kwd>
                <kwd>clinical variability</kwd>
                <kwd>short stature</kwd>
                <kwd>intellectual disability</kwd>
                <kwd>congenital heart disease</kwd>
            </kwd-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro" id="sec-01">
            <label>1.</label>
            <title>Introduction</title>
            <p>Noonan syndrome (NS; OMIM#163950) is an autosomal dominant disorder characterized by craniofacial dysmorphism, such as short webbed neck (68.4%), downslanted palpebral fissures (46.6%), low posteriorly rotated ears (43.3%), and microcephaly (32.5%). Other features include congenital heart diseases (CHD) (83.8%), thoracic and musculoskeletal deformities (short stature) (77.4%), intellectual disabilities (ID) (20%) [<xref ref-type="bibr" rid="B-001">1</xref>,<xref ref-type="bibr" rid="B-002">2</xref>,<xref ref-type="bibr" rid="B-003">3</xref>], and other additional extracardiac features. The incidence of NS is estimated to be 1 in 1000-2500 live births [<xref ref-type="bibr" rid="B-004">4</xref>,<xref ref-type="bibr" rid="B-005">5</xref>].</p>
            <p>NS is a heterogeneous condition, with variable phenotypic expression and severity. The syndrome is associated with pathogenic variants in multiple genes in the Ras/Mitogen-Activated Protein Kinase (RAS-MAPK) pathway, which regulates growth and differentiation, leading to dysregulation. More than eight different genes associated with NS, such as <italic>PTPN11</italic> (61%), <italic>SOS1</italic> (12%), <italic>RAF1</italic> (7%), <italic>RIT1</italic> (5%), <italic>LZTR1</italic> (4%), and other implicated genes, including <italic>SOS2</italic>, <italic>BRAF</italic>, <italic>KRAS</italic>, <italic>MAP2K1</italic>, <italic>MRAS</italic>, <italic>NRAS</italic>, <italic>RASA2</italic>, and <italic>RRAS2</italic>, are required to diagnose NS.</p>
            <p>Pathogenic variants in the <italic>PTPN11</italic> gene are the major cause of NS, with missense mutations responsible for about 50% of NS cases. This gene encodes the tyrosine protein phosphatase non-receptor (SHP2), which is involved in Extracellular Signal-Regulated Kinase (ERK) activation via the RAS-MAPK pathway [<xref ref-type="bibr" rid="B-006">6</xref>]. <italic>PTPN11</italic> is located on chromosome 12q24 and contains 15 exons, encoding a total of 593 amino acids. Variants in <italic>PTPN11</italic> are most frequently found in exons 3 and 8 [<xref ref-type="bibr" rid="B-007">7</xref>]. The hotspot variant in the <italic>PTPN11</italic> gene associated with NS is c.922A&#x003E;G (p.Asn308Asp) in exon 8. This variant has been widely studied and reported across a range of populations with prevalence of 16.3% to 43%. The second, c.1510A&#x003E;G (p.Met504Val) in exon 3, is less prevalent, with a range of 4.2% to 16.3% [<xref ref-type="bibr" rid="B-001">1</xref>]. Other recurrent variants include c.417G&#x003E;C (p.Glu139Asp) in exon 8, c.836A&#x003E;G (p.Tyr279Cys) in exon 7, and c.1403C&#x003E;T (p.Thr468Met) in exon 13, which are also often found in populations [<xref ref-type="bibr" rid="B-008">8</xref>].</p>
            <p>The <italic>PTPN11</italic> gene is expressed in various tissues and plays a crucial role in regulating eukaryotic cell responses to multiple extracellular signals, such as hormones, cytokines, and growth factors. Mutations in <italic>PTPN11</italic> can be inherited in an autosomal dominant manner or occur de novo. The mutations involved in NS are considered gain-of-function mutations that cause inappropriate prolongation of the RAS/MAPK signaling pathway. The prolonged RAS/MAPK pathway leads to the pleomorphic characteristics in NS [<xref ref-type="bibr" rid="B-009">9</xref>].</p>
            <p>NS is characterized by a broad spectrum of symptoms and physical features that vary greatly in range and severity, and can change with age. The most consistent features are wide-set eyes, low-set ears, short stature, and pulmonary valve stenosis [<xref ref-type="bibr" rid="B-009">9</xref>,<xref ref-type="bibr" rid="B-010">10</xref>]. The diagnosis of NS syndrome depends on the identification of characteristic clinical features [<xref ref-type="bibr" rid="B-010">10</xref>,<xref ref-type="bibr" rid="B-011">11</xref>].</p>
            <p>Clinical diagnosis of NS based on the diagnostic criteria for NS. Until recently, diagnosis was made based on clinical features. Molecular genetic testing can confirm approximately 70% of cases [<xref ref-type="bibr" rid="B-010">10</xref>]. There are major and minor criteria, along with some features, for establishing the diagnosis of NS (<xref ref-type="table" rid="T-01">Table 1</xref>). The features are facial features, cardiac features, height, chest wall shape, family history, and other characteristics such as ID, cryptorchidism, and lymphatic vessel dysplasia [<xref ref-type="bibr" rid="B-011">11</xref>].</p>
            <table-wrap id="T-01" orientation="portrait" position="float">
                <label>Table 1</label>
                <caption>
                    <title>Diagnostic Criteria for Noonan syndrome [<xref ref-type="bibr" rid="B-012">12</xref>].</title>
                </caption>
                <table frame="hsides" rules="none">
                    <thead>
                        <tr>
                            <td align="left" valign="middle"><bold>Feature</bold></td>
                            <td align="left" valign="middle"><bold>A = Major</bold></td>
                            <td align="left" valign="middle"><bold>B = Minor</bold></td>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" valign="middle">Facial</td>
                            <td align="left" valign="middle">Typical facial dysmorphology (facial features vary with age)</td>
                            <td align="left" valign="middle">Suggestive facial dysmorphology</td>
                        </tr>
                        <tr>
                            <td align="left" valign="middle">Cardiac</td>
                            <td align="left" valign="middle">Pulmonary valve stenosis, hypertrophic cardiomyopathy, and/or electrocardiographic results typical of Noonan syndrome</td>
                            <td align="left" valign="middle">Other defect</td>
                        </tr>
                        <tr>
                            <td align="left" valign="middle">Height</td>
                            <td align="left" valign="middle">&#x003C;3<sup>rd</sup> percentile</td>
                            <td align="left" valign="middle">&#x003C;10<sup>th</sup> percentile</td>
                        </tr>
                        <tr>
                            <td align="left" valign="middle">Chest wall</td>
                            <td align="left" valign="middle">Pectus carinatum/excavatum</td>
                            <td align="left" valign="middle">Broad thorax</td>
                        </tr>
                        <tr>
                            <td align="left" valign="middle">Family history</td>
                            <td align="left" valign="middle">First-degree relative with definite Noonan syndrome</td>
                            <td align="left" valign="middle">First-degree relative with suggestive Noonan syndrome</td>
                        </tr>
                        <tr>
                            <td align="left" valign="middle">Other features</td>
                            <td align="left" valign="middle">All of the following: intellectual disability, cryptorchidism, and lymphatic vessel dysplasia</td>
                            <td align="left" valign="middle">One of the following: intellectual disability, cryptorchidism, and lymphatic vessel dysplasia</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <fn id="TF-01-01"><p>Note: Noonan syndrome is considered present if the patient has typical facial dysmorphology plus one feature from categories 2A through 6A of two categories from features 2B through 6B, or has suggestive facial dysmorphology plus two features from categories 2A through 6A or three features from categories 2B through 6B.</p></fn>
                    <fn id="TF-01-02"><p>Adapted with permission from van der Burgt et al. [<xref ref-type="bibr" rid="B-012">12</xref>].</p></fn>
                </table-wrap-foot>  
            </table-wrap>
        </sec>
        <sec sec-type="materials|methods" id="sec-02">
            <label>2.</label>
            <title>Materials and Methods</title>
            <p>We included 29 patients who visited the Cytogenetic and Molecular Laboratory, Biomedical Research Center Laboratory (CEBIOR), Faculty of Medicine Universitas Diponegoro, Semarang, Indonesia. The inclusion criteria for subjects are age 0-18 years old who were diagnosed with NS based on Van der Burgt criteria (<xref ref-type="table" rid="T-01">Table 1</xref>) and were clinically confirmed by an experienced pediatrician.</p>
            <sec id="sec-02-01">
                <label>2.1</label>
                <title>Clinical Examination</title>
                <p>Patients were described according to craniofacial features, cardiac defects, and systemic manifestations. Short stature was defined as a height-for-age z-score (HAZ) below -2 standard deviation (SD) or less than the 3<sup>rd</sup> percentile. In contrast, severe short stature was defined as HAZ below -3 SD, plotted on World Health Organization (WHO) graphics for subjects below 5 years old, and Centers for Disease Control and Prevention (CDC) for subjects &#x003E;5 years old. Clinical data were obtained from hospital medical records.</p>
            </sec>
            <sec id="sec-02-02">
                <label>2.2</label>
                <title>Molecular Analysis</title>
                <p>Genomic DNA was isolated from peripheral blood samples using the QIAamp DNA Mini Kit (QIAGEN, Pune, India) at CEBIOR, Faculty of Medicine, Diponegoro University, Indonesia. The Polymerase Chain Reaction (PCR) has been performed in a 30 &#x00B5;l reaction volume containing 2 &#x00B5;l genomic DNA, 15 &#x00B5;l GoTaq Green Master Mix 2X (Promega Corporation Company, Madison, Wisconsin, United States), 0.5 &#x00B5;l 10 &#x00B5;M forward and 0.5 &#x00B5;l 10 &#x00B5;M reverse primer by Genetika Science Indonesia, Tangerang, Indonesia, and 12 &#x00B5;l nuclease-free water. Cycling parameters were 45 cycles of 95&#x00B0;C for 30 seconds (denaturation); 54-60&#x00B0;C for 30 seconds (annealing); and 68&#x00B0;C for 90 seconds (extension), followed by 68&#x00B0;C for 7 minutes (final extension step). Please refer to <xref ref-type="table" rid="T-02">Table 2</xref> for the primer sequences, annealing temperatures, and size of PCR products for each primer pair.</p>
                <table-wrap id="T-02" orientation="portrait" position="float">
                    <label>Table 2</label>
                    <caption>
                        <title>Primer Sequences, Annealing Temperatures, and Product Lengths to Amplify <italic>PTPN11</italic> [<xref ref-type="bibr" rid="B-008">8</xref>].</title>
                    </caption>
                    <table frame="hsides" rules="none">
                        <thead>
                            <tr>
                                <td align="left" valign="middle" rowspan="2"><bold>Exon</bold></td>
                                <td align="left" valign="middle" colspan="2"><bold>Primer Sequence (5&#x2019; &#x2192; 3&#x2019;)</bold></td>
                                <td align="left" valign="middle" rowspan="2"><bold>Annealing Temperatures (&#x00B0;C)</bold></td>
                                <td align="left" valign="middle" rowspan="2"><bold>Product Length (bp)</bold></td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle"><bold>Forward</bold></td>
                                <td align="left" valign="middle"><bold>Reverse</bold></td>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" valign="middle">1</td>
                                <td align="left" valign="middle">GCTGACGGGAAGCAGGAAGTGG</td>
                                <td align="left" valign="middle">CTGGCACCCGTGGTTCCCTC</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">589</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">2</td>
                                <td align="left" valign="middle">ACTGAATCCCAGGTCTCTACCAAG</td>
                                <td align="left" valign="middle">CAGCAAGCTATCCAAGCATGGT</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">405</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">3</td>
                                <td align="left" valign="middle">CGACGTGGAAGATGAGATCTGA</td>
                                <td align="left" valign="middle">CAGTCACAAGCCTTTGGAGTCAG</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">384</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">4</td>
                                <td align="left" valign="middle">AGGAGAGCTGACTGTATACAGTAG</td>
                                <td align="left" valign="middle">CATCTGTAGGTGATAGAGCAAGA</td>
                                <td align="left" valign="middle">58</td>
                                <td align="left" valign="middle">447</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">5</td>
                                <td align="left" valign="middle">CTGCAGTGAACATGAGAGTGCTTG</td>
                                <td align="left" valign="middle">GTTGAAGCTGCAATGGGTACATG</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">329</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">6</td>
                                <td align="left" valign="middle">TGCATTAACACCGTTTTCTGT</td>
                                <td align="left" valign="middle">GTCAGTTTCAAGTCTCTCAGGTC</td>
                                <td align="left" valign="middle">54</td>
                                <td align="left" valign="middle">282</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">7</td>
                                <td align="left" valign="middle">GAACATTTCCTAGGATGAATTCC</td>
                                <td align="left" valign="middle">GGTACAGAGGTGCTAGGAATCA</td>
                                <td align="left" valign="middle">56</td>
                                <td align="left" valign="middle">271</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">8</td>
                                <td align="left" valign="middle">GACATCAGGCAGTGTTCACGTTAC</td>
                                <td align="left" valign="middle">CCTTAAAGTTACTTTCAGGACATG</td>
                                <td align="left" valign="middle">57</td>
                                <td align="left" valign="middle">350</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">9</td>
                                <td align="left" valign="middle">GTAAGCTTTGCTTTTCACAGTG</td>
                                <td align="left" valign="middle">CTAAACATGGCCAATCTGACATGTC</td>
                                <td align="left" valign="middle">56</td>
                                <td align="left" valign="middle">357</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">10</td>
                                <td align="left" valign="middle">GCAAGACTTGAACATTTGTTTGTTGC</td>
                                <td align="left" valign="middle">GACCCTGAATTCCTACACACCATC</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">284</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">11</td>
                                <td align="left" valign="middle">CAAAAGGAGACGAGTTCTGGGAAC</td>
                                <td align="left" valign="middle">GCAGTTGCTCTATGCCTCAAACAG</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">453</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">12</td>
                                <td align="left" valign="middle">GCTCCAAAGAGTAGACATTGTTTC</td>
                                <td align="left" valign="middle">GACTGTTTTCGTGAGCACTTTC</td>
                                <td align="left" valign="middle">56</td>
                                <td align="left" valign="middle">250</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">13</td>
                                <td align="left" valign="middle">CAACACTGTAGCCATTGCAACA</td>
                                <td align="left" valign="middle">CGTATCCAAGAGGCCTAGCAAG</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">356</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">14</td>
                                <td align="left" valign="middle">ACCATTGTCCCTCACATGTGC</td>
                                <td align="left" valign="middle">CAGTGAAAGGCATGTGCTACAAAC</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">259</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">15</td>
                                <td align="left" valign="middle">CAGGTCCTAGGCACAGGAACTG</td>
                                <td align="left" valign="middle">ACATTCCCAAATTGCTTGCCT</td>
                                <td align="left" valign="middle">60</td>
                                <td align="left" valign="middle">321</td>
                            </tr>
                        </tbody>
                    </table> 
                </table-wrap>
                <p>Sanger DNA sequencing was performed at the Integrated Laboratory for Research and Testing (LPPT) Universitas Gadjah Mada, Yogyakarta, Indonesia. The first purification was performed using the Exo-Sap protocol with a mixture of 5 &#x00B5;l of PCR product and 2 &#x00B5;l of ExoSap-IT, then incubated in a thermalcycler at 32&#x00B0;C for 15 minutes and 80&#x00B0;C for the next 15 minutes. Cycle sequencing was performed in 1 &#x00B5;l BigDye Terminator Ready Mix, 2 &#x00B5;l Buffer 5&#x00D7;, 1 &#x00B5;l forward/reverse primer (3.2 pmol), 1 &#x00B5;l template DNA, and 5 &#x00B5;l ddH<sub>2</sub>O. Cycling parameters were 25 cycles of 96&#x00B0;C for 10 seconds (denaturation); 50&#x00B0;C for 5 seconds (annealing); 60&#x00B0;C for 4 minutes (extension); and 4&#x00B0;C for hold. The second purification was performed using BigDye X-Terminator Purification kit (BDX) (Applied Biosystems, Foster City, CA, USA) with a mixture of 10 &#x00B5;l of sequencing template result, 45 &#x00B5;l SAM solution, and 10 &#x00B5;l BDX. Electrophoresis was performed in an Applied Biosystem 3500 Genetic Analyzer (Applied Biosystem).</p>
                <p>Exome sequencing was performed on five of 29 samples at the Genome Diagnostics Nijmegen, Department of Human Genetics, Radboud University Medical Center, The Netherlands, using Illumina NovaSeq 6000, after exome enrichment with the Twist Exome 2.0 plus Comprehensive Exome Spike-in Kit (Twist Bioscene, South San Francisco, United States).</p>
            </sec>
            <sec id="sec-02-03">
                <label>2.3</label>
                <title>Variant Analysis</title>
                <p>The Human Gene Mutation Database (HGMD), the National Center for Biotechnology Information (NCBI) database, GnomAD (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://gnomad.broadinstitute.org/">https://gnomad.broadinstitute.org/</ext-link>), and ClinVar (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://www.ncbi.nlm.nih.gov/clinvar/">https://www.ncbi.nlm.nih.gov/clinvar/</ext-link>) databases were used to confirm the pathogenicity status of the variant. The novel variant was analyzed for pathogenicity in silico using Polymorphism Phenotyping (PolyPhen) (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="http://genetics.bwh.harvard.edu/pph2/">http://genetics.bwh.harvard.edu/pph2/</ext-link>), Rare Exome Variant Ensemble Learner (REVEL) (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://sites.google.com/site/revelgenomics/">https://sites.google.com/site/revelgenomics/</ext-link>), Sorting Intolerant From Tolerant (SIFT) (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://sift.bii.a-star.edu.sg/sift4g/">https://sift.bii.a-star.edu.sg/sift4g/</ext-link>), and Functional Analysis through Hidden Markov Models (FATHMM_pred) (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://fathmm.biocompute.org.uk/">https://fathmm.biocompute.org.uk/</ext-link>), and MutationTaster_pred (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://www.mutationtaster.org/">https://www.mutationtaster.org/</ext-link>).</p>
            </sec>
            <sec id="sec-02-04">
                <label>2.4</label>
                <title>Ethics Statement</title>
                <p>This study had been reviewed and approved by the Health Research Ethics Committee of the Faculty of Medicine, Universitas Diponegoro, Semarang, Indonesia [No. 336/EC/KEPK/FK-UNDIP/VII/2024]. Written informed consent to participate in this study, including for the publication of any potentially identifiable images in this paper, was provided by the participants&#x2019; legal guardian.</p>
            </sec>
        </sec>
        <sec sec-type="results" id="sec-03">
            <label>3.</label>
            <title>Results</title>
            <sec id="sec-03-01">
                <label>3.1</label>
                <title>PTPN11 Variants</title>
                <p>We identified a total of 18 patients (62%) with <italic>PTPN11</italic> variants in 29 patients (<xref ref-type="table" rid="T-03">Table 3</xref>), all of which have been previously reported as pathogenic, and one novel variant. Thirteen patients had missense changes in exon 8: 11 patients have a missense variant in c.907G&#x003E;A (p.Asp303Asn), this change was the most common variant observed in our study (37.93%), one patient has a variant in c.922A&#x003E;G (p.Asn308Asp), and another in c.854T&#x003E;C (p.Phe285Ser). Three patients have variants in exon 13: two patients have a variant in c.1510A&#x003E;G (p.Met504Val), and one has c.1517A&#x003E;C (p.Gln506Pro). Two patients have a variant in exon 3 c.184T&#x003E;G (p.Tyr62Asp) and c.140G&#x003E;A (p.Arg47Lys); most of these pathogenic variants have previously been reported, as shown in <xref ref-type="table" rid="T-03">Table 3</xref> [<xref ref-type="bibr" rid="B-008">8</xref>,<xref ref-type="bibr" rid="B-013">13</xref>,<xref ref-type="bibr" rid="B-014">14</xref>]. A novel variant, c.140G&#x003E;A (p.Arg47Lys), was identified in exon 3 and analyzed for pathogenicity in silico using PolyPhen and REVEL.</p>
                <table-wrap id="T-03" orientation="portrait" position="float">
                    <label>Table 3</label>
                    <caption>
                        <title><italic>PTPN11</italic> variants found in this study.</title>
                    </caption>
                    <table frame="hsides" rules="none">
                        <thead>
                            <tr>
                                <td align="left" valign="middle"><bold>DNA</bold></td>
                                <td align="left" valign="middle"><bold>Protein</bold></td>
                                <td align="left" valign="middle"><bold>Exon</bold></td>
                                <td align="left" valign="middle"><bold>Number of patients</bold></td>
                                <td align="left" valign="middle"><bold>Reference</bold></td>
                                <td align="left" valign="middle"><bold>Clin Var</bold></td>
                                <td align="left" valign="middle"><bold>GnomAD</bold></td>
                                <td align="left" valign="middle"><bold>PolyPhen</bold></td>
                                <td align="left" valign="middle"><bold>REVEL</bold></td>
                                <td align="left" valign="middle"><bold>SIFT</bold></td>
                                <td align="left" valign="middle"><bold>FATHMM Pred</bold></td>
                                <td align="left" valign="middle"><bold>MutationTaster</bold></td>
                                <td align="left" valign="middle"><bold>Conservation</bold></td>
                                <td align="left" valign="middle"><bold>Classification</bold></td>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" valign="middle">c.184T&#x003E;G</td>
                                <td align="left" valign="middle">p.Tyr62Asp</td>
                                <td align="left" valign="middle">3</td>
                                <td align="left" valign="middle">1</td>
                                <td align="left" valign="middle">[<xref ref-type="bibr" rid="B-008">8</xref>,<xref ref-type="bibr" rid="B-013">13</xref>,<xref ref-type="bibr" rid="B-014">14</xref>]</td>
                                <td align="left" valign="middle">Pathogenic (ID 13329)</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Probably damaging</td>
                                <td align="left" valign="middle">0.996</td>
                                <td align="left" valign="middle">Deleterious (Damaging)</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Pathogenic</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">c.140G&#x003E;A</td>
                                <td align="left" valign="middle">p.Arg47Lys</td>
                                <td align="left" valign="middle">3</td>
                                <td align="left" valign="middle">1</td>
                                <td align="left" valign="middle">-</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Probably damaging</td>
                                <td align="left" valign="middle">0.869</td>
                                <td align="left" valign="middle">0.36 Tolerated</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Pathogenic</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">c.854T&#x003E;C</td>
                                <td align="left" valign="middle">p.Phe285Ser</td>
                                <td align="left" valign="middle">8</td>
                                <td align="left" valign="middle">1</td>
                                <td align="left" valign="middle">[<xref ref-type="bibr" rid="B-008">8</xref>,<xref ref-type="bibr" rid="B-014">14</xref>]</td>
                                <td align="left" valign="middle">Pathogenic (ID 13335)</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Probably damaging</td>
                                <td align="left" valign="middle">1.000</td>
                                <td align="left" valign="middle">Deleterious (Damaging)</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Pathogenic</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">c.907G&#x003E;A</td>
                                <td align="left" valign="middle">p.Asp303Asn</td>
                                <td align="left" valign="middle">8</td>
                                <td align="left" valign="middle">11</td>
                                <td align="left" valign="middle">[<xref ref-type="bibr" rid="B-015">15</xref>]</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Probably damaging</td>
                                <td align="left" valign="middle">0.533</td>
                                <td align="left" valign="middle">Deleterious (Damaging)</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Variant of Unknown Significance</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">c.922A&#x003E;G</td>
                                <td align="left" valign="middle">p.Asn308Asp</td>
                                <td align="left" valign="middle">8</td>
                                <td align="left" valign="middle">1</td>
                                <td align="left" valign="middle">[<xref ref-type="bibr" rid="B-008">8</xref>,<xref ref-type="bibr" rid="B-013">13</xref>,<xref ref-type="bibr" rid="B-014">14</xref>]</td>
                                <td align="left" valign="middle">Pathogenic (ID 13326)</td>
                                <td align="left" valign="middle">Pathogenic</td>
                                <td align="left" valign="middle">Probably damaging</td>
                                <td align="left" valign="middle">0.625</td>
                                <td align="left" valign="middle">Deleterious (Damaging)</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Pathogenic</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">c.1510A&#x003E;G</td>
                                <td align="left" valign="middle">p.Met504Val</td>
                                <td align="left" valign="middle">13</td>
                                <td align="left" valign="middle">2</td>
                                <td align="left" valign="middle">[<xref ref-type="bibr" rid="B-008">8</xref>,<xref ref-type="bibr" rid="B-013">13</xref>]</td>
                                <td align="left" valign="middle">Pathogenic (ID 40562)</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Pathogenic</td>
                                <td align="left" valign="middle">0.843</td>
                                <td align="left" valign="middle">Deleterious (Damaging)</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Pathogenic</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">c.1517A&#x003E;C</td>
                                <td align="left" valign="middle">p.Gln506Pro</td>
                                <td align="left" valign="middle">13</td>
                                <td align="left" valign="middle">1</td>
                                <td align="left" valign="middle">[<xref ref-type="bibr" rid="B-008">8</xref>]</td>
                                <td align="left" valign="middle">Pathogenic (ID 40563)</td>
                                <td align="left" valign="middle">Absent</td>
                                <td align="left" valign="middle">Probably damaging</td>
                                <td align="left" valign="middle">0.900</td>
                                <td align="left" valign="middle">Deleterious (Damaging)</td>
                                <td align="left" valign="middle">Damaging/Pathogenic</td>
                                <td align="left" valign="middle">Deleterious</td>
                                <td align="left" valign="middle">Conserved</td>
                                <td align="left" valign="middle">Pathogenic</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn id="TF-03"><p>All <italic>PTPN11</italic> variants listed in this table are predicted to cause NS in a dominant form.</p></fn>
                    </table-wrap-foot>  
                </table-wrap>
            </sec>
            <sec id="sec-03-02">
                <label>3.2</label>
                <title>Phenotype Analysis</title>
                <p>A wide range of phenotypic variability is observed among NS patients with a <italic>PTPN11</italic> pathogenic variant, demonstrating variable expressivity and penetrance. Of the 18 patients with a <italic>PTPN11</italic> variant, 50% of patients were male. Age at diagnosis ranged from &#x003C;1 month to 7 years 4 months. The mean HAZ was -3.28 SD, while the weight-for-height z-score (WHZ) mean was -1.66 SD. Nine of 18 patients (50%) came with the chief complaint of weight faltering and experienced feeding difficulties in infancy. Two of 18 patients (11.1%) were short in stature. Other clinical manifestations were described (<xref ref-type="table" rid="T-04">Table 4</xref>) to demonstrate the clinical variabilities in <italic>PTPN11</italic> pathogenic variants in Indonesian NS patients.</p>
                <table-wrap id="T-04" orientation="portrait" position="float">
                    <label>Table 4</label>
                    <caption>
                        <title>Phenotypic features in patients with positive <italic>PTPN11</italic> pathogenic variant.</title>
                    </caption>
                    <table frame="hsides" rules="none">
                        <thead>
                            <tr>
                                <td align="left" valign="middle"><bold>Phenotypic features</bold></td>
                                <td align="left" valign="middle"><bold>Percentage in <italic>PTPN11-</italic>positive patients in our study (n = 18)</bold></td>
                                <td align="left" valign="middle"><bold>Percentage in <italic>PTPN11</italic>-positive patients worldwide</bold> [<xref ref-type="bibr" rid="B-002">2</xref>,<xref ref-type="bibr" rid="B-003">3</xref>,<xref ref-type="bibr" rid="B-013">13</xref>,<xref ref-type="bibr" rid="B-016">16</xref>,<xref ref-type="bibr" rid="B-017">17</xref>,<xref ref-type="bibr" rid="B-018">18</xref>,<xref ref-type="bibr" rid="B-019">19</xref>,<xref ref-type="bibr" rid="B-020">20</xref>,<xref ref-type="bibr" rid="B-021">21</xref>,<xref ref-type="bibr" rid="B-022">22</xref>,<xref ref-type="bibr" rid="B-023">23</xref>]</td>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" valign="middle" colspan="3"><bold>Craniofacial characteristics</bold></td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Abnormal head shape</td>
                                <td align="left" valign="middle">2 (11.1%)</td>
                                <td align="left" valign="middle">5/31 (16.1%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Microcephaly</td>
                                <td align="left" valign="middle">9 (50%)</td>
                                <td align="left" valign="middle">13/40 (32.5%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Tall forehead with narrow temples</td>
                                <td align="left" valign="middle">5 (27.8%)</td>
                                <td align="left" valign="middle">34/107 (31.8%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Thin and curly scalp hair</td>
                                <td align="left" valign="middle">5 (27.8%)</td>
                                <td align="left" valign="middle">9/107 (8.4%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Prominent eyes</td>
                                <td align="left" valign="middle">7 (38.9%)</td>
                                <td align="left" valign="middle">10/38</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Hypertelorism</td>
                                <td align="left" valign="middle">8 (44.4%)</td>
                                <td align="left" valign="middle">68/135 (50.4%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Downslanted palpebral fissure</td>
                                <td align="left" valign="middle">9 (50%)</td>
                                <td align="left" valign="middle">19/28 (67.9%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Depressed nasal bridge</td>
                                <td align="left" valign="middle">8 (44.4%)</td>
                                <td align="left" valign="middle">17/38 (44.7%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Bulbous nose</td>
                                <td align="left" valign="middle">5 (27.8%)</td>
                                <td align="left" valign="middle">17/38 (44.7%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Upturned/downturned mouth</td>
                                <td align="left" valign="middle">4 (22.2%)</td>
                                <td align="left" valign="middle">-</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Short chin</td>
                                <td align="left" valign="middle">4 (22.2%)</td>
                                <td align="left" valign="middle">110/124 (88.7%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Low-set posteriorly-rotated ear</td>
                                <td align="left" valign="middle">15 (83.3%)</td>
                                <td align="left" valign="middle">96/137 (70.1%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Short neck, webbed neck</td>
                                <td align="left" valign="middle">9 (50%)</td>
                                <td align="left" valign="middle">65/107 (60.7%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle" colspan="3"><bold>Systemic manifestations</bold></td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Arms deformities</td>
                                <td align="left" valign="middle">3 (16.7%)</td>
                                <td align="left" valign="middle">18/71 (25.4%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Legs deformities</td>
                                <td align="left" valign="middle">6 (33.3%)</td>
                                <td align="left" valign="middle">18/71 (25.4%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Palmar crease</td>
                                <td align="left" valign="middle">3 (16.7%)</td>
                                <td align="left" valign="middle">5/41 (12.2%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Cryptorchidism</td>
                                <td align="left" valign="middle">4 (22.2%)</td>
                                <td align="left" valign="middle">27/32 (84.4%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Lymphatic vessel dysplasia</td>
                                <td align="left" valign="middle">2 (11.1%)</td>
                                <td align="left" valign="middle">43/115 (37.4%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Intellectual disability</td>
                                <td align="left" valign="middle">9 (50%)</td>
                                <td align="left" valign="middle">4/17 (23.5%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Cancer and hematologic disorders</td>
                                <td align="left" valign="middle">4 (22.2%)</td>
                                <td align="left" valign="middle">2/18 (11.1%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Dental and oral disorders</td>
                                <td align="left" valign="middle">5 (27.8%)</td>
                                <td align="left" valign="middle">17/29 (58.6%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Cutaneous manifestations or ectodermal involvement</td>
                                <td align="left" valign="middle">1 (5.6%)</td>
                                <td align="left" valign="middle">70/129 (54.3%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Gastrointestinal manifestations</td>
                                <td align="left" valign="middle">3 (16.7%)</td>
                                <td align="left" valign="middle">16/25 (64%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Genitourinary and renal manifestations</td>
                                <td align="left" valign="middle">2 (11.1%)</td>
                                <td align="left" valign="middle">10/35 (28.6%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Hearing loss</td>
                                <td align="left" valign="middle">3 (16.7%)</td>
                                <td align="left" valign="middle">2/17 (11.8%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Short stature</td>
                                <td align="left" valign="middle">15 (83.3%)</td>
                                <td align="left" valign="middle">43/107 (40.2%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Hypothyroidism and autoimmune disorder</td>
                                <td align="left" valign="middle">7 (38.9%)</td>
                                <td align="left" valign="middle">6/42 (14.3%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Thoracic and musculoskeletal deformities</td>
                                <td align="left" valign="middle">14 (77.8%)</td>
                                <td align="left" valign="middle">3/18 (16.7%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle" colspan="3"><bold>Cardiac defects</bold></td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Pulmonary valve stenosis</td>
                                <td align="left" valign="middle">5 (27.8%)</td>
                                <td align="left" valign="middle">92/181 (50.8%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Atrial septal defect</td>
                                <td align="left" valign="middle">4 (22.2%)</td>
                                <td align="left" valign="middle">70/181 (38.7%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Pulmonary valve stenosis + atrial septal defect</td>
                                <td align="left" valign="middle">2 (11.1%)</td>
                                <td align="left" valign="middle">-</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Pulmonary valve stenosis + Patent Foramen Ovale</td>
                                <td align="left" valign="middle">2 (11.1%)</td>
                                <td align="left" valign="middle">6/22 (27.3%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Hypertrophy cardiomyopathy</td>
                                <td align="left" valign="middle">1 (5.6%)</td>
                                <td align="left" valign="middle">13/181 (7.2%)</td>
                            </tr>
                            <tr>
                                <td align="left" valign="middle">Patent Ductus Arteriosus + Ventricular septal defect + Pulmonary Hypertension</td>
                                <td align="left" valign="middle">1 (5.6%)</td>
                                <td align="left" valign="middle">-</td>
                            </tr>
                        </tbody>
                    </table>  
                </table-wrap>
                <p>A typical craniofacial feature of NS was observed in all patients. Features observed with high frequency in the patients with <italic>PTPN11</italic> pathogenic variants were low-set posteriorly rotated ears found in nearly all patients (83.3%), microcephaly, downslanted palpebral fissure and short-webbed neck found in nine patients (50%), hypertelorism and depressed nasal bridge in eight patients (44.4%), while thin and curly scalp hair, tall forehead with narrow temples, bulbous nose, and upturned/downturned mouth found in five patients (27.8%). CHD diagnosed by echocardiography was present in 15 patients (83.3%), pulmonary valve stenosis was the most common, either isolated (27.8%) or combined with atrial septal defect (ASD) (38.9%). Four of eighteen patients (22.2%) also developed an isolated ASD. CHD was seen most frequently in patients with pathogenic variants in exon 8 (10 out of 12 patients). Severe short stature was observed in 8 patients (44.4%), while short stature was found in 5 patients (27.8%). Other phenotypes observed in most patients (77.8%) include thoracic deformities or musculoskeletal manifestations (sternal deformities and finger-toes deformities). All patients with <italic>PTPN11</italic> pathogenic variants showed mild to moderate ID.</p>
                <p>Comorbidities were also observed in this study; one patient reported suffering from juvenile myelomonocytic leukemia. Furthermore, hypothyroidism, cholestasis, multiple caries dentis and cutis marmorata were also found in several patients. Three patients were reported to have hearing loss, which was acquired beyond childhood and was severe enough to require hearing aids. Laryngomalacia was reported in one patient, which was corrected by surgery.</p>
            </sec>
        </sec>
        <sec sec-type="discussion" id="sec-04">
            <label>4.</label>
            <title>Discussion</title>
            <p>To the best of our knowledge, this is the first study involving a relatively large NS patient cohort in Indonesia. Missense mutations in <italic>PTPN11</italic> cause NS and involve a gain-of-function mechanism. In the present study, we identified <italic>PTPN11</italic> changes in 18 (62%) out of 29 patients, all of whom had sporadic NS. These findings are limited as we performed only on selected exons, including <italic>PTPN11</italic> exons 3, 4, 8, 11, and 13. The result is consistent with previous studies, which reported that <italic>PTPN11</italic> pathogenic variants were present in 50% of NS cases [<xref ref-type="bibr" rid="B-024">24</xref>,<xref ref-type="bibr" rid="B-025">25</xref>,<xref ref-type="bibr" rid="B-026">26</xref>,<xref ref-type="bibr" rid="B-027">27</xref>]. Other genes responsible for NS, such as <italic>SOS1</italic>, <italic>SOS2</italic>, <italic>BRAF</italic>, <italic>KRAS</italic>, <italic>MAP2K1</italic>, <italic>MRAS</italic>, <italic>NRAS</italic>, <italic>RAF1</italic>, <italic>RASA2</italic>, <italic>RIT1</italic>, <italic>RRAS2</italic>, and <italic>LZTR1</italic>, may still be found in other patients. Further examination to study these genes and exons will be planned in the future as well.</p>
            <p>Six of the 18 pathogenic variants identified in this study were previously reported missense changes. The majority of variants were found in exon 8, as reported in earlier studies, accounting for 72.2% of the <italic>PTPN11</italic> pathogenic variants (<xref ref-type="table" rid="T-03">Table 3</xref>). In this study, 18 (62%) of those with <italic>PTPN11</italic> pathogenic variants had variants in exons 3, 8, and 13; this proportion is consistent with that observed in most studies [<xref ref-type="bibr" rid="B-013">13</xref>,<xref ref-type="bibr" rid="B-028">28</xref>,<xref ref-type="bibr" rid="B-029">29</xref>,<xref ref-type="bibr" rid="B-030">30</xref>,<xref ref-type="bibr" rid="B-031">31</xref>].</p>
            <p>However, one pathogenic variant (c.140G&#x003E;A p.(Arg47Lys)) represents a novel finding within the N-terminal SH2 domain (N-SH2). N-SH2 plays a critical regulatory role as a key regulatory domain of the protein. This variant has not been previously reported in major population databases and literature [<xref ref-type="bibr" rid="B-006">6</xref>]. Variants affecting the N-SH2 domain of <italic>PTPN11</italic> are associated with NS due to a gain-of-function that destabilizes the autoinhibitory interaction between the N-SH2 and Protein Tyrosine Phosphatase (PTP) domains. Thus, SHP2 becomes excessively active, leading to hyperactivation of the RAS-MAPK pathway and dysregulated developmental signaling [<xref ref-type="bibr" rid="B-032">32</xref>]. In silico predictive tools suggest that the variant is probably damaging, and conservation analysis demonstrates it is highly conserved across species, indicating potential functional importance [<xref ref-type="bibr" rid="B-033">33</xref>].</p>
            <p>The missense variant in c.907G&#x003E;A p.(Asp303Asn) was the most common pathogenic variant we identified. This variant was previously reported in a case of Kawasaki disease in NS by Takai et al. In silico analysis predicted that it was &#x201C;probably damaging&#x201D; by Poplyphen2 with a prediction score of 0.533, adding further evidence of the occurrence of this variant in another NS patient [<xref ref-type="bibr" rid="B-015">15</xref>]. A missense variant, c.922A&#x003E;G (p.Asn308Asp), found in one patient, is consistent with earlier studies on PTPN11 pathogenic variants, which identified c.922A&#x003E;G as a mutation hotspot for NS-causing missense changes [<xref ref-type="bibr" rid="B-008">8</xref>,<xref ref-type="bibr" rid="B-013">13</xref>,<xref ref-type="bibr" rid="B-014">14</xref>].</p>
            <p>Sequence variant c.907G&#x003E;A p.(Asp303Asn) is likely to represent a non-synonymous single-nucleotide polymorphism (nsSNP) that causes NS in Javanese, Southeast Asian, and Indonesian populations. In our case, we have collected data on family trees; however, we have not found evidence of familial segregation. Therefore, functional studies are needed for this variant. The pathogenic nsSNPs of <italic>PTPN11</italic> c.907G&#x003E;A p.(Asp303Asn) were analyzed by five in-silico pathogenicity tools, such as PolyPhen, REVEL, SIFT, FATHMM Pred, and MutationTaster. The results support a deleterious effect on protein function in some predictors, but with the REVEL score of 0.533, it is not convincing enough to categorize it as likely pathogenic. With only one previous case report of a Noonan Syndrome patient with this variant [<xref ref-type="bibr" rid="B-015">15</xref>], we classified it as a variant of unknown significance (VUS), which will need further evidence to reclassify it, according to the American College of Medical Genetics and Genomics (ACMG) guidelines [<xref ref-type="bibr" rid="B-034">34</xref>]. Considering that about 30% of nsSNPs may influence clinical phenotypes by altering post-translational modifications (PTMs), protein stability, and protein-protein interactions, functional studies and clinical correlation are recommended for definitive pathogenicity confirmation [<xref ref-type="bibr" rid="B-035">35</xref>,<xref ref-type="bibr" rid="B-036">36</xref>].</p>
            <p>The SNPs in the coding region of human genes were associated with genetic disorders. A large number of SNPs have been reported in the database, making it difficult to screen them all for a particular phenotype. Computational analysis tools help narrow down and examine pathogenic SNPs for specific genetic disorders, thereby minimizing risk [<xref ref-type="bibr" rid="B-037">37</xref>,<xref ref-type="bibr" rid="B-038">38</xref>].</p>
            <p>In many previous studies, genotype-phenotype correlations have been widely investigated. However, the result obtained is that within the same pathogenic variant location, a wide range of clinical variability is observed [<xref ref-type="bibr" rid="B-024">24</xref>]. Several studies describe the role of SHP2 in regulating various developmental processes and the possible causes of this variation [<xref ref-type="bibr" rid="B-039">39</xref>,<xref ref-type="bibr" rid="B-040">40</xref>,<xref ref-type="bibr" rid="B-041">41</xref>].</p>
            <p>Variability in craniofacial features may vary due to subjective assessment. Low-set posteriorly rotated ears (83.3%) are the most commonly observed in our study, followed by microcephaly, downslanted palpebral fissure, and short-webbed neck (50%). Hypertelorism and depressed nasal bridge are present in eight (44.4%) patients, while prominent eyes are present in seven (38.9%) of the 18 cases. The mean age is 1 year 11 months, with children being the majority of cases, consistent with the literature on craniofacial features in childhood with NS. In the childhood category, the head is relatively abnormal in shape, with low-set, posteriorly rotated ears, downslanted palpebral fissures, a wide forehead, epicanthal folds, a short-webbed neck, and sternal deformities (pectus carinatum or excavatum). Hypertelorism, ptosis, or thick, hooded eyelids are characteristics. The nose is short and wide with a depressed root [<xref ref-type="bibr" rid="B-042">42</xref>]. Thereafter, due to age changes, the craniofacial features become less noticeable in adulthood.</p>
            <p>Severe short stature (HAZ below -3 SD) and short stature (HAZ below -2 SD or at the 3rd percentile) were seen in 13 (72.2%) of 18 patients with <italic>PTPN11</italic> pathogenic variants. Proportionate short stature is present in more than 50% of cases. The molecular mechanism by which NS-causing SHP2 mutants induce growth retardation had been reported previously [<xref ref-type="bibr" rid="B-043">43</xref>]. SHP2 mutations in NS by a postreceptor signaling defect cause mild Growth Hormone (GH) resistance, which is partially compensated by increased GH secretion. In children with SHP2 mutations who have a poor response to rhGH, this defect may contribute to the short stature phenotype [<xref ref-type="bibr" rid="B-044">44</xref>]. Growth delay was associated with low Insulin-like Growth Factor 1 (IGF-1) levels during the early postweaning growth phase. Impaired IGF-1 production contributes to growth retardation in NS. This is in agreement with clinical data showing that NS patients, notably those carrying a <italic>PTPN11</italic> mutation, display low IGF-1 levels [<xref ref-type="bibr" rid="B-039">39</xref>]. GH treatment in NS is thought to be beneficial because the dysmorphic findings are similar to those in Turner syndrome. Therefore, GH has been administered at the same dose used in the treatment of Turner syndrome [<xref ref-type="bibr" rid="B-045">45</xref>,<xref ref-type="bibr" rid="B-046">46</xref>].</p>
            <p>NS is the second most common syndromic cause of congenital heart disease, exceeded in prevalence only by trisomy 21 [<xref ref-type="bibr" rid="B-023">23</xref>]. Clinical manifestations of CHD problems are the most common reasons that prompt patients to see a doctor. In this study, CHD was found in 15 patients (83.3%) with <italic>PTPN11</italic> pathogenic variants. Pulmonary valve stenosis, seen in 9 patients (50%), was the most common finding in the present study, followed by atrial septal defects in 6 patients (33.3%), either isolated or combined with other types. Compared to the data from the previous study, NS patients with the <italic>PTPN11</italic> pathogenic variant are more likely to be associated with pulmonary valve stenosis or ASD [<xref ref-type="bibr" rid="B-047">47</xref>]. <italic>PTPN11</italic> encodes the Src homology-2 domain-containing protein tyrosine phosphatase and is reported to be associated with enlargement of the aortic annulus and aortic root [<xref ref-type="bibr" rid="B-048">48</xref>,<xref ref-type="bibr" rid="B-049">49</xref>].</p>
            <p>Thoracic and musculoskeletal deformities of NS consist of insufficient and/or delayed growth, causing short stature, and axial skeletal deformities, including sternal deformities, vertebral anomalies, cubitus valgus, and finger-toes abnormalities. Sternal deformities, such as pectus carinatum and/or excavatum, were presented in 10 (55.6%) of the 18 cases with <italic>PTPN11</italic> pathogenic variants. Four patients (27.8%) had widely-spaced nipples, and the chest circumference was measured across the internipple line. The internipple index was calculated according to the formula: internipple distance (cm) multiplied by 100 and divided by chest circumference (cm). The internipple distance and chest circumference increased with age. The internipple index in the neonatal period was the highest among all ages (26.4 &#x00B1; 1.6 for males and 26.3 &#x00B1; 2 for females), and will gradually decrease until the age of four years (23.8 &#x00B1; 1.2 for males and 23.8 &#x00B1; 1.4 for females), thereafter it would be relatively constant through the age of 18 years in males and the age of 11 years in females [<xref ref-type="bibr" rid="B-048">48</xref>].</p>
            <p>Neurological manifestations and cognitive and behavioral changes in individuals with NS are highly variable. Heterogeneity in cognitive abilities within RAS-MAPK signaling pathway syndromes has been observed, which depends on the affected gene and the variant type. IQ tests were not examined; instead, the cognitive &#x0026; behavioural changes were assessed by a Social Pediatric Consultant using the Denver II as a screening tool to identify potential ID. This assessment evaluated four developmental areas: personal-social, fine-motor-adaptive, language, and gross-motor skills. Eight patients (44.4%) were found to have global developmental delay, as their screening test results did not align with their actual age. In these patients, neurodevelopmental and hearing function evaluations should be performed [<xref ref-type="bibr" rid="B-050">50</xref>].</p>
            <p>Cryptorchidism may be present in males with NS and have an increased risk of infertility. While females with NS generally have normal puberty and fertility, males may experience delayed puberty and reduced fertility due to cryptorchidism and other potential gonadal issues. Male gonadal dysfunction has also been reported and is suggested to be caused by primary Sertoli cell dysfunction rather than cryptorchidism [<xref ref-type="bibr" rid="B-051">51</xref>]. Among the nine male patients in this study, four have cryptorchidism, although all the patients have undergone orchidopexy as corrective surgery.</p>
            <p>Lymphatic vessel dysplasia with a clinical lymphatic abnormality is a major feature of NS. Six NS patients (33.3%) with <italic>PTPN11</italic> pathogenic variants had lower limb lymphedema. Lower limb lymphedema and genital lymphedema are the two most reported types of lymphedema that develop after birth [<xref ref-type="bibr" rid="B-052">52</xref>]. The presentation of lymphedema in NS may vary, including differences in timing and resolution of edema at different ages. Haque et al. [<xref ref-type="bibr" rid="B-053">53</xref>] reported prenatal and postnatal onset of lymphatic abnormalities in NS, whereas postnatal onset might result in a milder phenotype.</p>
            <p>A broad spectrum of ophthalmologic features is found in NS, with downslanted palpebral fissures (50%) being the most common finding in <italic>PTPN11</italic> pathogenic variants, followed by depressed nasal bridge, hypertelorism (44.4%), and prominent eyes (38.9%). Marin et al. [<xref ref-type="bibr" rid="B-054">54</xref>] reported that the most common ophthalmologic feature finding (74%) in patients with <italic>PTPN11</italic> pathogenic variants was downslanted palpebral fissures. Refractive errors are not examined. Based on the literature, refractive errors and ptosis are often detected and reported in patients with <italic>PTPN11</italic> pathogenic variants [<xref ref-type="bibr" rid="B-055">55</xref>].</p>
            <p>Several hematological disorders are predisposed to occur in NS, including transient monocytosis, thrombocytopenia, and myeloproliferative disorder [<xref ref-type="bibr" rid="B-056">56</xref>]. The most common haematologic disorders are coagulation defects, manifested as bleeding abnormalities [<xref ref-type="bibr" rid="B-057">57</xref>]. In this study, one NS patient with a <italic>PTPN11</italic> pathogenic variant had severe anemia, while other patients had haemangioma and juvenile myelomonocytic leukemia. Several hematological cancers have been reported in patients with NS during childhood, including juvenile myelomonocytic leukemia, acute myelogenous leukemia, and B-cell acute lymphoblastic leukemia [<xref ref-type="bibr" rid="B-057">57</xref>].</p>
            <p>Despite a few studies reporting an autoimmune thyroiditis in NS, an earlier study showed an association between hypothyroidism and NS. In a patient with NS, primary hypothyroidism is an uncommon condition that may develop either separately or in conjunction with NS. Although the precise etiology of this condition is unknown, age, excessive iodine intake, and heredity can make an individual more susceptible. One NS patient in this study was found to have hypothyroidism and undertreatment with Euthyrax. A multidisciplinary approach is required for these individuals with comorbidities or related conditions to NS [<xref ref-type="bibr" rid="B-058">58</xref>].</p>
            <p>Gastrointestinal manifestations such as liver problems, including elevated liver enzymes, autoimmune hepatitis, and even human hepatocellular carcinoma (HCC), can occur in NS due to its genetic basis affecting the RAS-MAPK pathway, which is commonly seen in other RASopathies like progressive familial intrahepatic cholestasis (PFIC) [<xref ref-type="bibr" rid="B-059">59</xref>]. We reported one NS patient with a pathogenic <italic>PTPN11</italic> variant with cholestasis. Liver problems in NS are less frequent; a previous study by Rippert [<xref ref-type="bibr" rid="B-060">60</xref>] revealed a strong association between NS and neonatal liver disease, particularly neonatal hyperbilirubinemia and cholestatic disease. Since the pathogenesis of these conditions has not been definitively linked to NS, understanding the spectrum of liver phenotypes in NS remains a subject of ongoing investigation.</p>
            <p>NS is linked to various orodental manifestations reported in several studies. High-arched palate, micrognathia, and macrodontia, which can result in malocclusion and misalignment of teeth, have been reported repeatedly in case reports and retrospective studies [<xref ref-type="bibr" rid="B-061">61</xref>]. High arched palate and caries dentis are common dental problems in NS.</p>
            <p>Cutis marmorata teleangiectatica congenita (CMTC), a cutaneous or ectodermal manifestation of NS, was found in one patient in this study. CMTC is a possible associated anomaly in NS, even though it is not a primary feature. Cutaneous findings are common in NS with <italic>BRAF</italic>, <italic>KRAS</italic>, and <italic>SHOC2</italic> variants [<xref ref-type="bibr" rid="B-062">62</xref>].</p>
            <p>The study&#x2019;s retrospective design had some limitations. We tried to combine the correlations between genotypes and phenotypes based on follow-up results in the medical records from the last examination. Due to the high cost and the fact that genetic testing is not covered by national health insurance, genetic testing has only been performed on selected exons, those frequently reported to cause NS mutations, which were evaluated. Moreover, the relatively small cohort may not adequately represent the broader population variability and may have biased the results. However, this study is, to the best of our knowledge, the first to explore genotype-phenotype correlations of NS. in the Indonesian population, which might be a basis for further study in NS.</p>
        </sec>
        <sec sec-type="conclusions" id="sec-05">
            <label>5.</label>
            <title>Conclusions</title>
            <p>NS has broad clinical manifestations, and each patient presents with mixed clinical features. Clinicians need to raise awareness of suspecting NS, since the incidence rate is relatively high, and be concerned about comorbidities. Early diagnosis can be achieved by maintaining a high index of suspicion in children with short stature, ID, CHD, and musculoskeletal deformities that have a distinctive facial dysmorphism at any age. Whole exome sequencing or gene panel is the gold standard for NS and other RASopathies. However, in this developing country, Indonesia, where most of the cases come from families with low economic backgrounds, genetic testing is very expensive and not covered by government health insurance. In these situations, based on the results of our study, we might suggest molecular testing, such as Sanger sequencing, for patients clinically suspected of having NS, performed only at several mutation hotspots, such as exons 3, 8, and 13.</p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgments</title>
            <p>The authors thank the subjects and their families for participating in this study. We thank Radboud University Medical Center for invaluable technical assistance with exome sequencing and a multiple gene panel for Noonan syndrome. Also, the authors would like to thank the patient and his parents for their willingness to participate in this study.</p>
        </ack>
        <notes>
            <title>Author Contributions</title>
            <p>All authors contributed to the study&#x2019;s design, data analysis, and manuscript preparation. Nisa Ayu Thayalisha Hadi led data collection, interpretation, and statistical analysis, while Agustini Utari and Nydia Rena Benita Sihombing assisted in manuscript writing. Tri Indah Winarni and Nani Maharani provided critical revisions to the manuscript and supervised the research project.</p>
        </notes>
        <notes>
            <title>Funding</title>
            <p>The study was fully supported by RPI grant from LPPM Universitas Diponegoro (Undip) number 609-46/UN7-D2/PP/VIII/2023. LPPM Undip had no direct role in study design, sample collection, data interpretation or manuscript preparation. The study was also supported by the Center for Biomedical Research (CEBIOR) Faculty of Medicine Undip.</p>
        </notes>
        <notes notes-type="conflict-interest">
            <title>Competing Interests</title>  
            <p>The authors have declared that no competing interests exist.</p>          
        </notes>
        <notes>
            <title>Data Availability Statement</title>
            <p>A list of genes involved in the <xref ref-type="table" rid="T-03">Table 3</xref> is available on the Human GRCh3/hg19 database on the UCSC Human Genome Browser website.</p>
        </notes>
        <notes>
            <title>AI-Assisted Technologies Statement</title>
            <p>Artificial intelligence (AI) tools were used solely for basic grammar correction and language refinement in the preparation of the manuscript. Specifically, Grammarly was employed to improve the readability and linguistic clarity of the English text. All scientific content, data interpretation, and conclusion were developed independently by the author. The authors have thoroughly reviewed and edited the AI-assisted text to ensure its accuracy and accept full responsibility for the content of the manuscript.</p>
        </notes>
        <ref-list>
            <title>References</title>
            <ref id="B-001">
                <label>1. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Zepeda-Olmos</surname><given-names>PM</given-names></name>,
                <name><surname>Esparza-Garc&#x00ED;a</surname><given-names>E</given-names></name>,
                <name><surname>Robles-Espinoza</surname><given-names>K</given-names></name>,
                <name><surname>Gonz&#x00E1;lez-Garc&#x00ED;a</surname><given-names>JR</given-names></name>,
                <name><surname>Rodr&#x00ED;guez Guti&#x00E9;rrez</surname><given-names>PG</given-names></name>,
                <name><surname>Maga&#x00F1;a-Torres</surname><given-names>MT</given-names></name>.
                <article-title>Variants of the <italic>PTPN11</italic> gene in Mexican patients with Noonan syndrome</article-title>.
                <source>Genes</source>.
                <year iso-8601-date="2024">2024</year>; 
                <volume>15</volume>: 
                <fpage>1379</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-002">
                <label>2. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Nazarie</surname><given-names>FV</given-names></name>,
                <name><surname>Miclea</surname><given-names>D</given-names></name>,
                <name><surname>&#x0218;ufan&#x0103;</surname><given-names>C</given-names></name>,
                <name><surname>Botezatu</surname><given-names>A</given-names></name>,
                <name><surname>Popp</surname><given-names>RA</given-names></name>,
                <name><surname>Pascanu</surname><given-names>IM</given-names></name>,
                <etal/>.
                <article-title>Clinical and genetic characterization of Noonan syndrome in a Romanian cohort from Transylvania: Details on <italic>PTPN11</italic> c.922A&#x003E;G variant and phenotypic spectrum</article-title>.
                <source>Diagnostics</source>.
                <year iso-8601-date="2025">2025</year>; 
                <volume>15</volume>: 
                <fpage>2753</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-003">
                <label>3. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Chen</surname><given-names>Q</given-names></name>,
                <name><surname>Hong</surname><given-names>D</given-names></name>,
                <name><surname>Huang</surname><given-names>Y</given-names></name>,
                <name><surname>Zhang</surname><given-names>Z</given-names></name>,
                <name><surname>Wang</surname><given-names>S</given-names></name>.
                <article-title>Phenotypic and genotypic spectrum of Noonan syndrome: A retrospective analysis of 46 consecutive pediatric patients presented at a regional cardiac center in China</article-title>.
                <source>Heliyon</source>.
                <year iso-8601-date="2024">2024</year>; 
                <volume>10</volume>: 
                <fpage>e27038</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-004">
                <label>4. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Romano</surname><given-names>AA</given-names></name>,
                <name><surname>Allanson</surname><given-names>JE</given-names></name>,
                <name><surname>Dahlgren</surname><given-names>J</given-names></name>,
                <name><surname>Gelb</surname><given-names>BD</given-names></name>,
                <name><surname>Hall</surname><given-names>B</given-names></name>,
                <name><surname>Pierpont</surname><given-names>ME</given-names></name>,
                <etal/>.
                <article-title>Noonan syndrome: Clinical features, diagnosis, and management guidelines</article-title>.
                <source>Pediatrics</source>.
                <year iso-8601-date="2010">2010</year>; 
                <volume>126</volume>: 
                <fpage>746</fpage>-<lpage>759</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-005">
                <label>5. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Prendiville</surname><given-names>TW</given-names></name>,
                <name><surname>Gauvreau</surname><given-names>K</given-names></name>,
                <name><surname>Tworog-Dube</surname><given-names>E</given-names></name>,
                <name><surname>Patkin</surname><given-names>L</given-names></name>,
                <name><surname>Kucherlapati</surname><given-names>RS</given-names></name>,
                <name><surname>Roberts</surname><given-names>AE</given-names></name>,
                <etal/>.
                <article-title>Cardiovascular disease in Noonan syndrome</article-title>.
                <source>Arch Dis Child</source>.
                <year iso-8601-date="2014">2014</year>; 
                <volume>99</volume>: 
                <fpage>629</fpage>-<lpage>634</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-006">
                <label>6. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Lepri</surname><given-names>F</given-names></name>,
                <name><surname>De Luca</surname><given-names>A</given-names></name>,
                <name><surname>Stella</surname><given-names>L</given-names></name>,
                <name><surname>Rossi</surname><given-names>C</given-names></name>,
                <name><surname>Baldassarre</surname><given-names>G</given-names></name>,
                <name><surname>Pantaleoni</surname><given-names>F</given-names></name>,
                <etal/>.
                <article-title><italic>SOS1</italic> mutations in Noonan syndrome: Molecular spectrum, structural insights on pathogenic effects, and genotype-phenotype correlations</article-title>.
                <source>Hum Mutat</source>.
                <year iso-8601-date="2011">2011</year>; 
                <volume>32</volume>: 
                <fpage>760</fpage>-<lpage>772</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-007">
                <label>7. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Lee</surname><given-names>SJ</given-names></name>,
                <name><surname>Jeong</surname><given-names>S</given-names></name>,
                <name><surname>Lee</surname><given-names>S</given-names></name>,
                <name><surname>Jung</surname><given-names>SH</given-names></name>,
                <name><surname>Suh</surname><given-names>MW</given-names></name>,
                <name><surname>Song</surname><given-names>JJ</given-names></name>,
                <etal/>.
                <article-title>Gene signatures and genotype-phenotype correlations of sensorineural hearing loss in Noonan syndrome and related RASopathies</article-title>.
                <source>Sci Rep</source>.
                <year iso-8601-date="2025">2025</year>; 
                <volume>15</volume>: 
                <fpage>12102</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-008">
                <label>8. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Athota</surname><given-names>JP</given-names></name>,
                <name><surname>Bhat</surname><given-names>M</given-names></name>,
                <name><surname>Nampoothiri</surname><given-names>S</given-names></name>,
                <name><surname>Gowrishankar</surname><given-names>K</given-names></name>,
                <name><surname>Narayanachar</surname><given-names>SG</given-names></name>,
                <name><surname>Puttamallesh</surname><given-names>V</given-names></name>,
                <etal/>.
                <article-title>Molecular and clinical studies in 107 Noonan syndrome affected individuals with <italic>PTPN11</italic> mutations</article-title>.
                <source>BMC Med Genet</source>.
                <year iso-8601-date="2020">2020</year>; 
                <volume>21</volume>: 
                <fpage>50</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-009">
                <label>9. </label>
                <mixed-citation publication-type="other" publication-format="web">
                <name><surname>Sharma</surname><given-names>L</given-names></name>,
                <name><surname>Winters</surname><given-names>R</given-names></name>,
                <name><surname>Morales</surname><given-names>A</given-names></name>.
                <article-title>Noonan syndrome</article-title>.
                <source>StatPearls [Internet]</source>.
                <publisher-loc>Treasure Island, FL</publisher-loc>:
                <publisher-name>StatPearls Publishing</publisher-name>;
                <year iso-8601-date="2026">2026</year>.
                <comment>Avaliable from: <ext-link  ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://www.ncbi.nlm.nih.gov/books/NBK532269/">https://www.ncbi.nlm.nih.gov/books/NBK532269/</ext-link>.</comment>
                </mixed-citation>
            </ref>
            <ref id="B-010">
                <label>10. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Bhambhani</surname><given-names>V</given-names></name>,
                <name><surname>Muenke</surname><given-names>M</given-names></name>.
                <article-title>Noonan syndrome</article-title>.
                <source>Am Fam Physician</source>.
                <year iso-8601-date="2014">2014</year>; 
                <volume>89</volume>: 
                <fpage>37</fpage>-<lpage>43</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-011">
                <label>11. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Carcavilla</surname><given-names>A</given-names></name>,
                <name><surname>Su&#x00E1;rez-Ortega</surname><given-names>L</given-names></name>,
                <name><surname>S&#x00E1;nchez</surname><given-names>AR</given-names></name>,
                <name><surname>Gonzalez-Casado</surname><given-names>I</given-names></name>,
                <name><surname>Ram&#x00F3;n-Krauel</surname><given-names>M</given-names></name>,
                <name><surname>Labarta</surname><given-names>JI</given-names></name>,
                <etal/>.
                <article-title>Noonan syndrome: Genetic and clinical update and treatment options</article-title>.
                <source>An Pediatr</source>.
                <year iso-8601-date="2020">2020</year>; 
                <volume>93</volume>: 
                <fpage>61.e1</fpage>-<lpage>61.e14</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-012">
                <label>12. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Van Der Burgt</surname><given-names>I</given-names></name>,
                <name><surname>Berends</surname><given-names>E</given-names></name>,
                <name><surname>Lommen</surname><given-names>E</given-names></name>,
                <name><surname>Van Beersum</surname><given-names>S</given-names></name>,
                <name><surname>Hamel</surname><given-names>B</given-names></name>,
                <name><surname>Mariman</surname><given-names>E</given-names></name>.
                <article-title>Clinical and molecular studies in a large Dutch family with Noonan syndrome</article-title>.
                <source>Am J Med Genet</source>.
                <year iso-8601-date="1994">1994</year>; 
                <volume>53</volume>: 
                <fpage>187</fpage>-<lpage>191</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-013">
                <label>13. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Ko</surname><given-names>JM</given-names></name>,
                <name><surname>Kim</surname><given-names>JM</given-names></name>,
                <name><surname>Kim</surname><given-names>GH</given-names></name>,
                <name><surname>Yoo</surname><given-names>HW</given-names></name>.
                <article-title><italic>PTPN11</italic>, <italic>SOS1</italic>, <italic>KRAS</italic>, and <italic>RAF1</italic> gene analysis, and genotype-phenotype correlation in Korean patients with Noonan syndrome</article-title>.
                <source>J Hum Genet</source>.
                <year iso-8601-date="2008">2008</year>; 
                <volume>53</volume>: 
                <fpage>999</fpage>-<lpage>1006</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-014">
                <label>14. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Beneteau</surname><given-names>C</given-names></name>,
                <name><surname>Cav&#x00E9;</surname><given-names>H</given-names></name>,
                <name><surname>Moncla</surname><given-names>A</given-names></name>,
                <name><surname>Dorison</surname><given-names>N</given-names></name>,
                <name><surname>Munnich</surname><given-names>A</given-names></name>,
                <name><surname>Verloes</surname><given-names>A</given-names></name>,
                <etal/>.
                <article-title><italic>SOS1</italic> and <italic>PTPN11</italic> mutations in five cases of Noonan syndrome with multiple giant cell lesions</article-title>.
                <source>Eur J Hum Genet</source>.
                <year iso-8601-date="2009">2009</year>; 
                <volume>17</volume>: 
                <fpage>1216</fpage>-<lpage>1221</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-015">
                <label>15. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Takai</surname><given-names>S</given-names></name>,
                <name><surname>Takasawa</surname><given-names>K</given-names></name>,
                <name><surname>Doi</surname><given-names>S</given-names></name>.
                <article-title>Atypical coronary artery aneurysms due to Kawasaki disease in Noonan syndrome with a novel <italic>PTPN11</italic> mutation</article-title>.
                <source>Cardiol Young</source>.
                <year iso-8601-date="2019">2019</year>; 
                <volume>29</volume>: 
                <fpage>228</fpage>-<lpage>230</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-016">
                <label>16. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Gargano</surname><given-names>MA</given-names></name>,
                <name><surname>Matentzoglu</surname><given-names>N</given-names></name>,
                <name><surname>Coleman</surname><given-names>B</given-names></name>,
                <name><surname>Addo-Lartey</surname><given-names>EB</given-names></name>,
                <name><surname>Anagnostopoulos</surname><given-names>AV</given-names></name>,
                <name><surname>Anderton</surname><given-names>J</given-names></name>,
                <etal/>.
                <article-title>The Human Phenotype Ontology in 2024: Phenotypes around the world</article-title>.
                <source>Nucleic Acids Res</source>.
                <year iso-8601-date="2024">2024</year>; 
                <volume>52</volume>: 
                <fpage>D1333</fpage>-<lpage>D1346</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-017">
                <label>17. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Swarts</surname><given-names>JW</given-names></name>,
                <name><surname>Kleimeier</surname><given-names>LE</given-names></name>,
                <name><surname>Leenders</surname><given-names>EK</given-names></name>,
                <name><surname>Rinne</surname><given-names>T</given-names></name>,
                <name><surname>Klein</surname><given-names>WM</given-names></name>,
                <name><surname>Draaisma</surname><given-names>JM</given-names></name>.
                <article-title>Lymphatic anomalies during lifetime in patients with Noonan syndrome: Retrospective cohort study</article-title>.
                <source>Am J Med Genet A</source>.
                <year iso-8601-date="2022">2022</year>; 
                <volume>188</volume>: 
                <fpage>3242</fpage>-<lpage>3261</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-018">
                <label>18. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Antal</surname><given-names>G</given-names></name>,
                <name><surname>Csabai</surname><given-names>L</given-names></name>,
                <name><surname>Zsigmond</surname><given-names>A</given-names></name>,
                <name><surname>Szanto</surname><given-names>I</given-names></name>,
                <name><surname>Hadzsiev</surname><given-names>K</given-names></name>,
                <name><surname>Bene</surname><given-names>J</given-names></name>.
                <article-title>Heterogeneity of Orodental features in a family with Noonan syndrome</article-title>.
                <source>Int J Mol Sci</source>.
                <year iso-8601-date="2025">2025</year>; 
                <volume>26</volume>: 
                <fpage>11414</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-019">
                <label>19. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Bessis</surname><given-names>D</given-names></name>,
                <name><surname>Miquel</surname><given-names>J</given-names></name>,
                <name><surname>Bourrat</surname><given-names>E</given-names></name>,
                <name><surname>Chiaverini</surname><given-names>C</given-names></name>,
                <name><surname>Morice-Picard</surname><given-names>F</given-names></name>,
                <name><surname>Abadie</surname><given-names>C</given-names></name>,
                <etal/>.
                <article-title>Dermatological manifestations in Noonan syndrome: A prospective multicentric study of 129 patients positive for mutation</article-title>.
                <source>Br J Dermatol</source>.
                <year iso-8601-date="2019">2019</year>; 
                <volume>180</volume>: 
                <fpage>1438</fpage>-<lpage>1448</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-020">
                <label>20. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Shah</surname><given-names>N</given-names></name>,
                <name><surname>Rodriguez</surname><given-names>M</given-names></name>,
                <name><surname>Louis</surname><given-names>DS</given-names></name>,
                <name><surname>Lindley</surname><given-names>K</given-names></name>,
                <name><surname>Milla</surname><given-names>PJ</given-names></name>.
                <article-title>Feeding difficulties and foregut dysmotility in Noonan&#x2019;s syndrome</article-title>.
                <source>Arch Dis Child</source>.
                <year iso-8601-date="1999">1999</year>; 
                <volume>81</volume>: 
                <fpage>28</fpage>-<lpage>31</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-021">
                <label>21. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Baldo</surname><given-names>F</given-names></name>,
                <name><surname>Fachin</surname><given-names>A</given-names></name>,
                <name><surname>Da Re</surname><given-names>B</given-names></name>,
                <name><surname>Rubinato</surname><given-names>E</given-names></name>,
                <name><surname>Bobbo</surname><given-names>M</given-names></name>,
                <name><surname>Barbi</surname><given-names>E</given-names></name>.
                <article-title>New insights on Noonan syndrome&#x2019;s clinical phenotype: A single center retrospective study</article-title>.
                <source>BMC Pediatr</source>.
                <year iso-8601-date="2022">2022</year>; 
                <volume>22</volume>: 
                <fpage>734</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-022">
                <label>22. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Casto</surname><given-names>C</given-names></name>,
                <name><surname>Pepe</surname><given-names>G</given-names></name>,
                <name><surname>Li Pomi</surname><given-names>A</given-names></name>,
                <name><surname>Corica</surname><given-names>D</given-names></name>,
                <name><surname>Aversa</surname><given-names>T</given-names></name>,
                <name><surname>Wasniewska</surname><given-names>M</given-names></name>.
                <article-title>Hashimoto&#x2019;s thyroiditis and Graves&#x2019; disease in genetic syndromes in pediatric age</article-title>.
                <source>Genes</source>.
                <year iso-8601-date="2021">2021</year>; 
                <volume>12</volume>: 
                <fpage>222</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-023">
                <label>23. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Sun</surname><given-names>L</given-names></name>,
                <name><surname>Xie</surname><given-names>YM</given-names></name>,
                <name><surname>Wang</surname><given-names>SS</given-names></name>,
                <name><surname>Zhang</surname><given-names>ZW</given-names></name>.
                <article-title>Cardiovascular abnormalities and gene mutations in children with Noonan syndrome</article-title>.
                <source>Front Genet</source>.
                <year iso-8601-date="2022">2022</year>; 
                <volume>13</volume>: 
                <fpage>915129</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-024">
                <label>24. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Narayanan</surname><given-names>DL</given-names></name>,
                <name><surname>Pandey</surname><given-names>H</given-names></name>,
                <name><surname>Moirangthem</surname><given-names>A</given-names></name>,
                <name><surname>Mandal</surname><given-names>K</given-names></name>,
                <name><surname>Gupta</surname><given-names>R</given-names></name>,
                <name><surname>Puri</surname><given-names>RD</given-names></name>,
                <etal/>.
                <article-title>Hotspots in <italic>PTPN11</italic> gene among Indian children with Noonan syndrome</article-title>.
                <source>Indian Pediatr</source>.
                <year iso-8601-date="2017">2017</year>; 
                <volume>54</volume>: 
                <fpage>638</fpage>-<lpage>640</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-025">
                <label>25. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Atik</surname><given-names>T</given-names></name>,
                <name><surname>Aykut</surname><given-names>A</given-names></name>,
                <name><surname>Hazan</surname><given-names>F</given-names></name>,
                <name><surname>Onay</surname><given-names>H</given-names></name>,
                <name><surname>Goksen</surname><given-names>D</given-names></name>,
                <name><surname>Darcan</surname><given-names>S</given-names></name>,
                <etal/>.
                <article-title>Mutation spectrum and phenotypic features in Noonan syndrome with <italic>PTPN11</italic> mutations: Definition of two novel mutations</article-title>.
                <source>Indian J Pediatr</source>.
                <year iso-8601-date="2016">2016</year>; 
                <volume>83</volume>: 
                <fpage>517</fpage>-<lpage>521</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-026">
                <label>26. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Maheshwari</surname><given-names>M</given-names></name>,
                <name><surname>Belmont</surname><given-names>J</given-names></name>,
                <name><surname>Fernbach</surname><given-names>S</given-names></name>,
                <name><surname>Ho</surname><given-names>T</given-names></name>,
                <name><surname>Molinari</surname><given-names>L</given-names></name>,
                <name><surname>Yakub</surname><given-names>I</given-names></name>,
                <etal/>.
                <article-title><italic>PTPN11</italic> mutations in Noonan syndrome type I: Detection of recurrent mutations in exons 3 and 13</article-title>.
                <source>Hum Mutat</source>.
                <year iso-8601-date="2002">2002</year>; 
                <volume>20</volume>: 
                <fpage>298</fpage>-<lpage>304</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-027">
                <label>27. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Essawi</surname><given-names>ML</given-names></name>,
                <name><surname>Ismail</surname><given-names>MF</given-names></name>,
                <name><surname>Afifi</surname><given-names>HH</given-names></name>,
                <name><surname>Kobesiy</surname><given-names>MM</given-names></name>,
                <name><surname>El Kotoury</surname><given-names>A</given-names></name>,
                <name><surname>Barakat</surname><given-names>MM</given-names></name>.
                <article-title>Mutational analysis of the <italic>PTPN11</italic> gene in Egyptian patients with Noonan syndrome</article-title>.
                <source>J Formos Med Assoc</source>.
                <year iso-8601-date="2013">2013</year>; 
                <volume>112</volume>: 
                <fpage>707</fpage>-<lpage>712</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-028">
                <label>28. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Zenker</surname><given-names>M</given-names></name>,
                <name><surname>Buheitel</surname><given-names>G</given-names></name>,
                <name><surname>Rauch</surname><given-names>R</given-names></name>,
                <name><surname>Koenig</surname><given-names>R</given-names></name>,
                <name><surname>Bosse</surname><given-names>K</given-names></name>,
                <name><surname>Kress</surname><given-names>W</given-names></name>,
                <etal/>.
                <article-title>Genotype-phenotype correlations in Noonan syndrome</article-title>.
                <source>J Pediatr</source>.
                <year iso-8601-date="2004">2004</year>; 
                <volume>144</volume>: 
                <fpage>368</fpage>-<lpage>374</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-029">
                <label>29. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Sarkozy</surname><given-names>A</given-names></name>,
                <name><surname>Conti</surname><given-names>E</given-names></name>,
                <name><surname>Seripa</surname><given-names>D</given-names></name>,
                <name><surname>Digilio</surname><given-names>MC</given-names></name>,
                <name><surname>Grifone</surname><given-names>N</given-names></name>,
                <name><surname>Tandoi</surname><given-names>C</given-names></name>,
                <etal/>.
                <article-title>Correlation between <italic>PTPN11</italic> gene mutations and congenital heart defects in Noonan and LEOPARD syndromes</article-title>.
                <source>J Med Genet</source>.
                <year iso-8601-date="2003">2003</year>; 
                <volume>40</volume>: 
                <fpage>704</fpage>-<lpage>708</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-030">
                <label>30. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Musante</surname><given-names>L</given-names></name>,
                <name><surname>Kehl</surname><given-names>HG</given-names></name>,
                <name><surname>Majewski</surname><given-names>F</given-names></name>,
                <name><surname>Meinecke</surname><given-names>P</given-names></name>,
                <name><surname>Schweiger</surname><given-names>S</given-names></name>,
                <name><surname>Gillessen-Kaesbach</surname><given-names>G</given-names></name>,
                <etal/>.
                <article-title>Spectrum of mutations in <italic>PTPN11</italic> and genotype-phenotype correlation in 96 patients with Noonan syndrome and five patients with cardio-facio-cutaneous syndrome</article-title>.
                <source>Eur J Hum Genet</source>.
                <year iso-8601-date="2003">2003</year>; 
                <volume>11</volume>: 
                <fpage>201</fpage>-<lpage>206</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-031">
                <label>31. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Jongmans</surname><given-names>M</given-names></name>,
                <name><surname>Sistermans</surname><given-names>EA</given-names></name>,
                <name><surname>Rikken</surname><given-names>A</given-names></name>,
                <name><surname>Nillesen</surname><given-names>WM</given-names></name>,
                <name><surname>Tamminga</surname><given-names>R</given-names></name>,
                <name><surname>Patton</surname><given-names>M</given-names></name>,
                <etal/>.
                <article-title>Genotypic and phenotypic characterization of Noonan syndrome: New data and review of the literature</article-title>.
                <source>Am J Med Genet A</source>.
                <year iso-8601-date="2005">2005</year>; 
                <volume>134</volume>: 
                <fpage>165</fpage>-<lpage>170</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-032">
                <label>32. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Tartaglia</surname><given-names>M</given-names></name>,
                <name><surname>Gelb</surname><given-names>BD</given-names></name>.
                <article-title>Noonan syndrome and related disorders: Genetics and pathogenesis</article-title>.
                <source>Annu Rev Genomics Hum Genet</source>.
                <year iso-8601-date="2005">2005</year>; 
                <volume>6</volume>: 
                <fpage>45</fpage>-<lpage>68</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-033">
                <label>33. </label>
                <mixed-citation publication-type="other" publication-format="web">UCSC.
                <article-title>UCSC Genome Browser on Human (GRCh37/hg19)</article-title> [Internet].
                <publisher-loc>Santa Cruz, CA</publisher-loc>:
                <publisher-name>UCSC</publisher-name>;
                <year iso-8601-date="2026">2026</year>.
                <comment>Avaliable from: <ext-link  ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&#x0026;lastVirtModeType=default&#x0026;lastVirtModeExtraState=&#x0026;virtModeType=default&#x0026;virtMode=0&#x0026;nonVirtPosition=&#x0026;position=chr12%3A112888119%2D112888129&#x0026;hgsid=3915766851_73JoJ8D5nOPazZ8sAU2t21AtH2WN">http://www.w3.org/1999/xlink" xlink:href="https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&#x0026;lastVirtModeType=default&#x0026;lastVirtModeExtraState=&#x0026;virtModeType=default&#x0026;virtMode=0&#x0026;nonVirtPosition=&#x0026;position=chr12%3A112888119%2D112888129&#x0026;hgsid=3915766851_73JoJ8D5nOPazZ8sAU2t21AtH2WN</ext-link>.</comment>
                </mixed-citation>
            </ref>
            <ref id="B-034">
                <label>34. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Richards</surname><given-names>S</given-names></name>,
                <name><surname>Aziz</surname><given-names>N</given-names></name>,
                <name><surname>Bale</surname><given-names>S</given-names></name>,
                <name><surname>Bick</surname><given-names>D</given-names></name>,
                <name><surname>Das</surname><given-names>S</given-names></name>,
                <name><surname>Gastier-Foster</surname><given-names>J</given-names></name>,
                <etal/>.
                <article-title>Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American college of medical genetics and genomics and the association for molecular pathology</article-title>.
                <source>Genet Med</source>.
                <year iso-8601-date="2015">2015</year>; 
                <volume>17</volume>: 
                <fpage>405</fpage>-<lpage>423</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-035">
                <label>35. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Pierpont</surname><given-names>EI</given-names></name>,
                <name><surname>Pierpont</surname><given-names>ME</given-names></name>,
                <name><surname>Mendelsohn</surname><given-names>NJ</given-names></name>,
                <name><surname>Roberts</surname><given-names>AE</given-names></name>,
                <name><surname>Tworog-Dube</surname><given-names>E</given-names></name>,
                <name><surname>Seidenberg</surname><given-names>MS</given-names></name>.
                <article-title>Genotype differences in cognitive functioning in Noonan syndrome</article-title>.
                <source>Genes Brain Behav</source>.
                <year iso-8601-date="2009">2009</year>; 
                <volume>8</volume>: 
                <fpage>275</fpage>-<lpage>282</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-036">
                <label>36. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Sigamani</surname><given-names>V</given-names></name>,
                <name><surname>Rajasingh</surname><given-names>S</given-names></name>,
                <name><surname>Gurusamy</surname><given-names>N</given-names></name>,
                <name><surname>Panda</surname><given-names>A</given-names></name>,
                <name><surname>Rajasingh</surname><given-names>J</given-names></name>.
                <article-title><italic>In-silico</italic> and <italic>in-vitro</italic> analysis of human <italic>SOS1</italic> protein causing Noonan syndrome-A novel approach to explore the molecular pathways</article-title>.
                <source>Curr Genomics</source>.
                <year iso-8601-date="2021">2021</year>; 
                <volume>22</volume>: 
                <fpage>526</fpage>-<lpage>540</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-037">
                <label>37. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Khimsuriya</surname><given-names>YM</given-names></name>,
                <name><surname>Chauhan</surname><given-names>JB</given-names></name>.
                <article-title>Pathogenic predictions of non-synonymous variants and their impacts: A computational assessment of <italic>ARHGEF6</italic> gene</article-title>.
                <source>Egypt J Med Hum Genet</source>.
                <year iso-8601-date="2018">2018</year>; 
                <volume>19</volume>: 
                <fpage>333</fpage>-<lpage>344</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-038">
                <label>38. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Nailwal</surname><given-names>M</given-names></name>,
                <name><surname>Chauhan</surname><given-names>JB</given-names></name>.
                <article-title>Computational analysis of high risk missense variant in human UTY gene: A candidate gene of AZFa sub-region</article-title>.
                <source>J Reprod Infertil</source>.
                <year iso-8601-date="2017">2017</year>; 
                <volume>18</volume>: 
                <fpage>298</fpage>-<lpage>306</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-039">
                <label>39. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Tajan</surname><given-names>M</given-names></name>,
                <name><surname>de Rocca Serra</surname><given-names>A</given-names></name>,
                <name><surname>Valet</surname><given-names>P</given-names></name>,
                <name><surname>Edouard</surname><given-names>T</given-names></name>,
                <name><surname>Yart</surname><given-names>A</given-names></name>.
                <article-title>SHP2 sails from physiology to pathology</article-title>.
                <source>Eur J Med Genet</source>.
                <year iso-8601-date="2015">2015</year>; 
                <volume>58</volume>: 
                <fpage>509</fpage>-<lpage>525</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-040">
                <label>40. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Serra-N&#x00E9;d&#x00E9;lec</surname><given-names>AD</given-names></name>,
                <name><surname>Edouard</surname><given-names>T</given-names></name>,
                <name><surname>Tr&#x00E9;guer</surname><given-names>K</given-names></name>,
                <name><surname>Tajan</surname><given-names>M</given-names></name>,
                <name><surname>Araki</surname><given-names>T</given-names></name>,
                <name><surname>Dance</surname><given-names>M</given-names></name>,
                <etal/>.
                <article-title>Noonan syndrome-causing SHP2 mutants inhibit insulin-like growth factor 1 release via growth hormone-induced ERK hyperactivation, which contributes to short stature</article-title>.
                <source>Proc Natl Acad Sci</source>.
                <year iso-8601-date="2012">2012</year>; 
                <volume>109</volume>: 
                <fpage>4257</fpage>-<lpage>4262</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-041">
                <label>41. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Araki</surname><given-names>T</given-names></name>,
                <name><surname>Chan</surname><given-names>G</given-names></name>,
                <name><surname>Newbigging</surname><given-names>S</given-names></name>,
                <name><surname>Morikawa</surname><given-names>L</given-names></name>,
                <name><surname>Bronson</surname><given-names>RT</given-names></name>,
                <name><surname>Neel</surname><given-names>BG</given-names></name>.
                <article-title>Noonan syndrome cardiac defects are caused by <italic>PTPN11</italic> acting in endocardium to enhance endocardial-mesenchymal transformation</article-title>.
                <source>Proc Natl Acad Sci</source>.
                <year iso-8601-date="2009">2009</year>; 
                <volume>106</volume>: 
                <fpage>4736</fpage>-<lpage>4741</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-042">
                <label>42. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Allanson</surname><given-names>JE</given-names></name>,
                <name><surname>Bohring</surname><given-names>A</given-names></name>,
                <name><surname>D&#x00F6;rr</surname><given-names>HG</given-names></name>,
                <name><surname>Dufke</surname><given-names>A</given-names></name>,
                <name><surname>Gillessen-Kaesbach</surname><given-names>G</given-names></name>,
                <name><surname>Horn</surname><given-names>D</given-names></name>,
                <etal/>.
                <article-title>The face of Noonan syndrome: Does phenotype predict genotype</article-title>.
                <source>Am J Med Genet A</source>.
                <year iso-8601-date="2010">2010</year>; 
                <volume>152</volume>: 
                <fpage>1960</fpage>-<lpage>1966</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-043">
                <label>43. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Binder</surname><given-names>G</given-names></name>,
                <name><surname>Neuer</surname><given-names>K</given-names></name>,
                <name><surname>Ranke</surname><given-names>MB</given-names></name>,
                <name><surname>Wittekindt</surname><given-names>NE</given-names></name>.
                <article-title><italic>PTPN11</italic> mutations are associated with mild growth hormone resistance in individuals with Noonan syndrome</article-title>.
                <source>J Clin Endocrinol Metab</source>.
                <year iso-8601-date="2005">2005</year>; 
                <volume>90</volume>: 
                <fpage>5377</fpage>-<lpage>5381</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-044">
                <label>44. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Limal</surname><given-names>JM</given-names></name>,
                <name><surname>Parfait</surname><given-names>B</given-names></name>,
                <name><surname>Cabrol</surname><given-names>S</given-names></name>,
                <name><surname>Bonnet</surname><given-names>D</given-names></name>,
                <name><surname>Leheup</surname><given-names>B</given-names></name>,
                <name><surname>Lyonnet</surname><given-names>S</given-names></name>,
                <etal/>.
                <article-title>Noonan syndrome: Relationships between genotype, growth, and growth factors</article-title>.
                <source>J Clin Endocrinol Metab</source>.
                <year iso-8601-date="2006">2006</year>; 
                <volume>91</volume>: 
                <fpage>300</fpage>-<lpage>306</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-045">
                <label>45. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Rodr&#x00ED;guez</surname><given-names>F</given-names></name>,
                <name><surname>Gaete</surname><given-names>X</given-names></name>,
                <name><surname>Cassorla</surname><given-names>F</given-names></name>.
                <article-title>Etiology and treatment of growth delay in Noonan syndrome</article-title>.
                <source>Front Endocrinol</source>.
                <year iso-8601-date="2021">2021</year>; 
                <volume>12</volume>: 
                <fpage>691240</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-046">
                <label>46. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Noonan</surname><given-names>JA</given-names></name>,
                <name><surname>Kappelgaard</surname><given-names>AM</given-names></name>.
                <article-title>The efficacy and safety of growth hormone therapy in children with Noonan syndrome: A review of the evidence</article-title>.
                <source>Horm Res Paediatr</source>.
                <year iso-8601-date="2015">2015</year>; 
                <volume>83</volume>: 
                <fpage>157</fpage>-<lpage>166</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-047">
                <label>47. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Yoshida</surname><given-names>R</given-names></name>,
                <name><surname>Hasegawa</surname><given-names>T</given-names></name>,
                <name><surname>Hasegawa</surname><given-names>Y</given-names></name>,
                <name><surname>Nagai</surname><given-names>T</given-names></name>,
                <name><surname>Kinoshita</surname><given-names>E</given-names></name>,
                <name><surname>Tanaka</surname><given-names>Y</given-names></name>,
                <etal/>.
                <article-title>Protein-tyrosine phosphatase, nonreceptor type 11 mutation analysis and clinical assessment in 45 patients with Noonan syndrome</article-title>.
                <source>J Clin Endocrinol Metab</source>.
                <year iso-8601-date="2004">2004</year>; 
                <volume>89</volume>: 
                <fpage>3359</fpage>-<lpage>3364</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-048">
                <label>48. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Tartaglia</surname><given-names>M</given-names></name>,
                <name><surname>Martinelli</surname><given-names>S</given-names></name>,
                <name><surname>Stella</surname><given-names>L</given-names></name>,
                <name><surname>Bocchinfuso</surname><given-names>G</given-names></name>,
                <name><surname>Flex</surname><given-names>E</given-names></name>,
                <name><surname>Cordeddu</surname><given-names>V</given-names></name>,
                <etal/>.
                <article-title>Diversity and functional consequences of germline and somatic <italic>PTPN11</italic> mutations in human disease</article-title>.
                <source>Am J Hum Genet</source>.
                <year iso-8601-date="2006">2006</year>; 
                <volume>78</volume>: 
                <fpage>279</fpage>-<lpage>290</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-049">
                <label>49. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Cornwall</surname><given-names>JW</given-names></name>,
                <name><surname>Green</surname><given-names>RS</given-names></name>,
                <name><surname>Nielsen</surname><given-names>JC</given-names></name>,
                <name><surname>Gelb</surname><given-names>BD</given-names></name>.
                <article-title>Frequency of aortic dilation in Noonan syndrome</article-title>.
                <source>Am J Cardiol</source>.
                <year iso-8601-date="2014">2014</year>; 
                <volume>113</volume>: 
                <fpage>368</fpage>-<lpage>371</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-050">
                <label>50. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Papadopoulou</surname><given-names>A</given-names></name>,
                <name><surname>Bountouvi</surname><given-names>E</given-names></name>.
                <article-title>Skeletal defects and bone metabolism in Noonan, Costello and Cardio-Facio-Cutaneous syndromes</article-title>.
                <source>Front Endocrinol</source>.
                <year iso-8601-date="2023">2023</year>; 
                <volume>14</volume>: 
                <fpage>1231828</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-051">
                <label>51. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Marcus</surname><given-names>KA</given-names></name>,
                <name><surname>Sweep</surname><given-names>CG</given-names></name>,
                <name><surname>Van der Burgt</surname><given-names>I</given-names></name>,
                <name><surname>Noordam</surname><given-names>C</given-names></name>.
                <article-title>Impaired Sertoli cell function in males diagnosed with Noonan syndrome</article-title>.
                <source>J Pediatr Endocrinol Metab</source>.
                <year iso-8601-date="2008">2008</year>; 
                <volume>21</volume>: 
                <fpage>1079</fpage>-<lpage>1084</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-052">
                <label>52. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Sleutjes</surname><given-names>J</given-names></name>,
                <name><surname>Kleimeier</surname><given-names>L</given-names></name>,
                <name><surname>Leenders</surname><given-names>E</given-names></name>,
                <name><surname>Klein</surname><given-names>W</given-names></name>,
                <name><surname>Draaisma</surname><given-names>J</given-names></name>.
                <article-title>Lymphatic abnormalities in Noonan syndrome spectrum disorders: A systematic review</article-title>.
                <source>Mol Syndromol</source>.
                <year iso-8601-date="2022">2022</year>; 
                <volume>13</volume>: 
                <fpage>1</fpage>-<lpage>11</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-053">
                <label>53. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Haque</surname><given-names>MA</given-names></name>,
                <name><surname>Sharmin</surname><given-names>LS</given-names></name>,
                <name><surname>Amin</surname><given-names>Z</given-names></name>,
                <name><surname>Ekram</surname><given-names>AS</given-names></name>.
                <article-title>Noonan syndrome presenting as lymphoedema precox</article-title>.
                <source>J Med</source>.
                <year iso-8601-date="2012">2012</year>; 
                <volume>13</volume>: 
                <fpage>243</fpage>-<lpage>245</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-054">
                <label>54. </label>
                <mixed-citation publication-type="journal">
                <name><surname>da Rocha Pitta Marin</surname><given-names>L</given-names></name>,
                <name><surname>Bezerra Gaspar Carvalho da Silva</surname><given-names>FT</given-names></name>,
                <name><surname>Ferreira de Sa</surname><given-names>LC</given-names></name>,
                <name><surname>Brasil</surname><given-names>AS</given-names></name>,
                <name><surname>Pereira</surname><given-names>A</given-names></name>,
                <name><surname>Furquim</surname><given-names>IM</given-names></name>,
                <etal/>.
                <article-title>Ocular manifestations of Noonan syndrome</article-title>.
                <source>Ophthalmic Genet</source>.
                <year iso-8601-date="2012">2012</year>; 
                <volume>33</volume>: 
                <fpage>1</fpage>-<lpage>5</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-055">
                <label>55. </label>
                <mixed-citation publication-type="other" publication-format="web">OMIM.
                <article-title>OMIM&#x00AE;: An Online Catalog of Human Genes and Genetic Disorders</article-title> [Internet].
                <publisher-loc>Baltimore, MD</publisher-loc>:
                <publisher-name>Johns Hopkins University</publisher-name>;
                <year iso-8601-date="2026">2026</year>.
                <comment>Avaliable from: <ext-link  ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://omim.org/">https://omim.org/</ext-link>.</comment>
                </mixed-citation>
            </ref>
            <ref id="B-056">
                <label>56. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Tartaglia</surname><given-names>M</given-names></name>,
                <name><surname>Gelb</surname><given-names>BD</given-names></name>.
                <article-title>Germ-line and somatic <italic>PTPN11</italic> mutations in human disease</article-title>.
                <source>Eur J Med Genet</source>.
                <year iso-8601-date="2005">2005</year>; 
                <volume>48</volume>: 
                <fpage>81</fpage>-<lpage>96</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-057">
                <label>57. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Nugent</surname><given-names>DJ</given-names></name>,
                <name><surname>Romano</surname><given-names>AA</given-names></name>,
                <name><surname>Sabharwal</surname><given-names>S</given-names></name>,
                <name><surname>Cooper</surname><given-names>DL</given-names></name>.
                <article-title>Evaluation of bleeding disorders in patients with Noonan syndrome: A systematic review</article-title>.
                <source>J Blood Med</source>.
                <year iso-8601-date="2018">2018</year>; 
                <volume>9</volume>: 
                <fpage>185</fpage>-<lpage>192</lpage>.
                </mixed-citation>
            </ref>
            <ref id="B-058">
                <label>58. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Khan</surname><given-names>QA</given-names></name>,
                <name><surname>Levin-Carrion</surname><given-names>Y</given-names></name>,
                <name><surname>Khan</surname><given-names>R</given-names></name>,
                <name><surname>Khan</surname><given-names>AZ</given-names></name>,
                <name><surname>Saddiq</surname><given-names>S</given-names></name>,
                <name><surname>Guddeti</surname><given-names>V</given-names></name>,
                <etal/>.
                <article-title>Hashimoto&#x2019;s thyroiditis in Noonan syndrome: A case report</article-title>.
                <source>Cureus</source>.
                <year iso-8601-date="2024">2024</year>; 
                <volume>16</volume>: 
                <fpage>e51592</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-059">
                <label>59. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Kakizaki</surname><given-names>S</given-names></name>,
                <name><surname>Uehara</surname><given-names>D</given-names></name>,
                <name><surname>Tojima</surname><given-names>H</given-names></name>,
                <name><surname>Suga</surname><given-names>T</given-names></name>,
                <name><surname>Yamazaki</surname><given-names>Y</given-names></name>,
                <name><surname>Sato</surname><given-names>K</given-names></name>,
                <etal/>.
                <article-title>The first reported case of Noonan syndrome complicated with hepatocellular carcinoma</article-title>.
                <source>Clin Case Rep</source>.
                <year iso-8601-date="2021">2021</year>; 
                <volume>9</volume>: 
                <fpage>e04317</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-060">
                <label>60. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Rippert</surname><given-names>A</given-names></name>,
                <name><surname>Strong</surname><given-names>A</given-names></name>,
                <name><surname>Ahrens-Nicklas</surname><given-names>R</given-names></name>.
                <article-title>O29: Characterization of liver disease in RASopathies</article-title>.
                <source>Genet Med Open</source>.
                <year iso-8601-date="2025">2025</year>; 
                <volume>3</volume>: 
                <fpage>102105</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-061">
                <label>61. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Esmaeelpour</surname><given-names>P</given-names></name>,
                <name><surname>Forghani</surname><given-names>M</given-names></name>,
                <name><surname>Karimpour</surname><given-names>S</given-names></name>.
                <article-title>Oral health and dental management strategies in Noonan syndrome: A case report</article-title>.
                <source>Iran Endod J</source>.
                <year iso-8601-date="2025">2025</year>; 
                <volume>20</volume>: 
                <fpage>e26</fpage>.
                </mixed-citation>
            </ref>
            <ref id="B-062">
                <label>62. </label>
                <mixed-citation publication-type="journal">
                <name><surname>Quaio</surname><given-names>CR</given-names></name>,
                <name><surname>de Almeida</surname><given-names>TF</given-names></name>,
                <name><surname>Brasil</surname><given-names>AS</given-names></name>,
                <name><surname>Pereira</surname><given-names>AC</given-names></name>,
                <name><surname>Jorge</surname><given-names>AA</given-names></name>,
                <name><surname>Malaquias</surname><given-names>AC</given-names></name>,
                <etal/>.
                <article-title>Tegumentary manifestations of Noonan and Noonan-related syndromes</article-title>.
                <source>Clinics</source>.
                <year iso-8601-date="2013">2013</year>; 
                <volume>68</volume>: 
                <fpage>1079</fpage>-<lpage>1083</lpage>.
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
</article>